Human SRGN(Serglycin) ELISA Kit

Human SRGN(Serglycin) ELISA Kit

Human Serglycin (SRGN) ELISA Kit

RD-SRGN-Hu-48Tests 48 Tests
EUR 521

Human Serglycin (SRGN) ELISA Kit

RD-SRGN-Hu-96Tests 96 Tests
EUR 723

Human Serglycin (SRGN) ELISA Kit

RDR-SRGN-Hu-48Tests 48 Tests
EUR 544

Human Serglycin (SRGN) ELISA Kit

RDR-SRGN-Hu-96Tests 96 Tests
EUR 756

Human Serglycin (SRGN) ELISA Kit

abx570659-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human SRGN/ Serglycin ELISA Kit

E2390Hu 1 Kit
EUR 571

Human SRGN(Serglycin) ELISA Kit

EH1207 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P10124
  • Alias: SRGN/Serglycin/Secretory granule proteoglycan core protein/Hematopoetic proteoglycan core protein/Platelet proteoglycan core protein/P.PG
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Serglycin, SRGN ELISA KIT

ELI-03491h 96 Tests
EUR 824

Human Serglycin (SRGN) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Serglycin (SRGN) ELISA Kit

abx250462-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Serglycin(SRGN) ELISA kit

CSB-EL022664HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Serglycin (SRGN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Serglycin(SRGN) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Serglycin(SRGN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Serglycin (SRGN) ELISA Kit

SEC869Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Serglycin (SRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Serglycin (SRGN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Serglycin (SRGN) ELISA Kit

SEC869Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Serglycin (SRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Serglycin (SRGN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Serglycin (SRGN) ELISA Kit

SEC869Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Serglycin (SRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Serglycin (SRGN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Serglycin (SRGN) ELISA Kit

SEC869Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Serglycin (SRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Serglycin (SRGN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Serglycin (SRGN) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Serglycin elisa. Alternative names of the recognized antigen: PRG
  • PPG
  • PRG1
  • proteoglycan 1, secretory granule
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Serglycin (SRGN) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Serglycin ELISA Kit (SRGN)

RK02336 96 Tests
EUR 521

Human Serglycin(SRGN)ELISA Kit

QY-E01413 96T
EUR 374

Mouse Serglycin (SRGN) ELISA Kit

abx515044-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Serglycin (SRGN) ELISA Kit

abx515045-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Srgn/ Serglycin ELISA Kit

E1412Mo 1 Kit
EUR 571

Mouse Serglycin, Srgn ELISA KIT

ELI-03490m 96 Tests
EUR 865

Mouse Serglycin (SRGN) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Serglycin (SRGN) ELISA Kit

SEC869Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Serglycin (SRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Serglycin (SRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Serglycin (SRGN) ELISA Kit

SEC869Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Serglycin (SRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Serglycin (SRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Serglycin (SRGN) ELISA Kit

SEC869Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Serglycin (SRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Serglycin (SRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Serglycin (SRGN) ELISA Kit

SEC869Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Serglycin (SRGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Serglycin (SRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Serglycin (SRGN) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Serglycin elisa. Alternative names of the recognized antigen: PRG
  • PPG
  • PRG1
  • proteoglycan 1, secretory granule
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Serglycin (SRGN) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Serglycin (SRGN) Antibody

abx145123-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Serglycin (SRGN) Antibody

  • EUR 342.00
  • EUR 857.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Serglycin (SRGN) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Serglycin (SRGN) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serglycin (SRGN) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serglycin (SRGN) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serglycin (SRGN) Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Serglycin (SRGN) Antibody

  • EUR 425.00
  • EUR 119.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Serglycin (SRGN) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serglycin (SRGN) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Serglycin (SRGN)

  • EUR 377.76
  • EUR 204.00
  • EUR 1141.60
  • EUR 447.20
  • EUR 794.40
  • EUR 316.00
  • EUR 2704.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P10124
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.4kDa
  • Isoelectric Point: 4.6
Description: Recombinant Human Serglycin expressed in: E.coli

Recombinant Serglycin (SRGN)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P13609
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.4kDa
  • Isoelectric Point: 4.6
Description: Recombinant Mouse Serglycin expressed in: E.coli

ELISA kit for Human SRGN (Serglycin)

E-EL-H2508 1 plate of 96 wells
EUR 534
  • Gentaur's SRGN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human SRGN. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human SRGN (Serglycin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human SRGN (Serglycin)

ELK3094 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Serglycin (SRGN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Serglycin (SRGN).
  • Show more
Description: A sandwich ELISA kit for detection of Serglycin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Serglycin (SRGN)

KTE60357-48T 48T
EUR 332
  • Serglycin is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydroly
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Serglycin (SRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Serglycin (SRGN)

KTE60357-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Serglycin is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydroly
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Serglycin (SRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Serglycin (SRGN)

KTE60357-96T 96T
EUR 539
  • Serglycin is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydroly
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Serglycin (SRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Serglycin (SRGN) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Serglycin (SRGN) Protein

  • EUR 537.00
  • EUR 244.00
  • EUR 1553.00
  • EUR 634.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Mouse SRGN (Serglycin)

ELK7758 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Serglycin (SRGN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Serglycin (SRGN).
  • Show more
Description: A sandwich ELISA kit for detection of Serglycin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat Serglycin (SRGN)

KTE100131-48T 48T
EUR 332
  • Serglycin is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydroly
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Serglycin (SRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Serglycin (SRGN)

KTE100131-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Serglycin is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydroly
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Serglycin (SRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Serglycin (SRGN)

KTE100131-96T 96T
EUR 539
  • Serglycin is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydroly
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Serglycin (SRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Serglycin (SRGN)

KTE70254-48T 48T
EUR 332
  • Serglycin is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydroly
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Serglycin (SRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Serglycin (SRGN)

KTE70254-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Serglycin is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydroly
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Serglycin (SRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Serglycin (SRGN)

KTE70254-96T 96T
EUR 539
  • Serglycin is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydroly
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Serglycin (SRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Serglycin (SRGN) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Serglycin (SRGN) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Serglycin (SRGN) Antibody (FITC)

  • EUR 495.00
  • EUR 258.00
  • EUR 1455.00
  • EUR 676.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Serglycin (SRGN) Antibody Pair

  • EUR 1650.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Serglycin (SRGN) Antibody (Biotin)

  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

SRGN Serglycin Human Recombinant Protein

PROTP10124 Regular: 20ug
EUR 317
Description: SRGN Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 156 amino acids (28-158) and having a molecular mass of 17.4 kDa (Molecular weight on SDS-PAGE will appear higher).;SRGN is fused to a 25 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Serglycin (SRGN) Monoclonal Antibody (Human)

  • EUR 255.00
  • EUR 2642.00
  • EUR 655.00
  • EUR 322.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Serglycin (SRGN)

Serglycin (SRGN) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRGN (Ala28~Ile152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serglycin (SRGN)

Serglycin (SRGN) Monoclonal Antibody (Human), APC

  • EUR 358.00
  • EUR 3455.00
  • EUR 957.00
  • EUR 458.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Serglycin (SRGN). This antibody is labeled with APC.

Serglycin (SRGN) Monoclonal Antibody (Human), Biotinylated

  • EUR 320.00
  • EUR 2592.00
  • EUR 760.00
  • EUR 394.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Serglycin (SRGN). This antibody is labeled with Biotin.

Serglycin (SRGN) Monoclonal Antibody (Human), Cy3

  • EUR 435.00
  • EUR 4565.00
  • EUR 1235.00
  • EUR 569.00
  • EUR 258.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Serglycin (SRGN). This antibody is labeled with Cy3.

Serglycin (SRGN) Monoclonal Antibody (Human), FITC

  • EUR 306.00
  • EUR 2784.00
  • EUR 786.00
  • EUR 386.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Serglycin (SRGN). This antibody is labeled with FITC.

Serglycin (SRGN) Monoclonal Antibody (Human), HRP

  • EUR 327.00
  • EUR 3011.00
  • EUR 846.00
  • EUR 413.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Serglycin (SRGN). This antibody is labeled with HRP.

Serglycin (SRGN) Monoclonal Antibody (Human), PE

  • EUR 306.00
  • EUR 2784.00
  • EUR 786.00
  • EUR 386.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Serglycin (SRGN). This antibody is labeled with PE.

SRGN Human, Serglycin Human Recombinant Protein, HEK

PROTP10124-1 Regular: 10ug
EUR 317
Description: Serglycin Human Recombinant produced in HEK cells is a single, glycosylated, polypeptide chain (Tyr28-Leu158) containing a total of 137 amino acids, having a calculated molecular mass of 15.5kDa and fused to a 6 aa His tag at C-Terminus.

Serglycin (SRGN) Monoclonal Antibody (Human), APC-Cy7

  • EUR 596.00
  • EUR 6790.00
  • EUR 1795.00
  • EUR 796.00
  • EUR 329.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Serglycin (SRGN). This antibody is labeled with APC-Cy7.

Serglycin (SRGN) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRGN (Ala28~Ile152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serglycin (SRGN). This antibody is labeled with APC.

Serglycin (SRGN) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRGN (Ala28~Ile152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serglycin (SRGN). This antibody is labeled with Biotin.

Serglycin (SRGN) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRGN (Ala28~Ile152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serglycin (SRGN). This antibody is labeled with Cy3.

Serglycin (SRGN) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRGN (Ala28~Ile152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serglycin (SRGN). This antibody is labeled with FITC.

Serglycin (SRGN) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRGN (Ala28~Ile152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serglycin (SRGN). This antibody is labeled with HRP.

Serglycin (SRGN) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRGN (Ala28~Ile152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serglycin (SRGN). This antibody is labeled with PE.

Serglycin (SRGN) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRGN (Ala28~Ile152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serglycin (SRGN). This antibody is labeled with APC-Cy7.

Srgn/ Rat Srgn ELISA Kit

ELI-03489r 96 Tests
EUR 886


ELA-E1072h 96 Tests
EUR 824


EF002715 96 Tests
EUR 689

ELISA kit for Human Serglycin

EK2690 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Serglycin in samples from serum, plasma, tissue homogenates and other biological fluids.

SRGN ELISA Kit (Human) (OKAN05303)

OKAN05303 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydrolytic enzymes. This encoded protein was found to be associated with the macromolecular complex of granzymes and perforin, which may serve as a mediator of granule-mediated apoptosis. Two transcript variants, only one of them protein-coding, have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.059 ng/mL

SRGN ELISA Kit (Human) (OKCD08281)

OKCD08281 96 Wells
EUR 975
Description: Description of target: SRGN is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydrolytic enzymes. SRGN was found to be associated with the macromolecular complex of granzymes and perforin, which may serve as a mediator of granule-mediated apoptosis.This gene encodes a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydrolytic enzymes. This encoded protein was found to be associated with the macromolecular complex of granzymes and perforin, which may serve as a mediator of granule-mediated apoptosis. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

SRGN ELISA Kit (Human) (OKEH00741)

OKEH00741 96 Wells
EUR 662
Description: Description of target: This gene encodes a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydrolytic enzymes. This encoded protein was found to be associated with the macromolecular complex of granzymes and perforin, which may serve as a mediator of granule-mediated apoptosis. Two transcript variants, only one of them protein-coding, have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.086 ng/mL

Human Serglycin Antibody

33290-05111 150 ug
EUR 261

Serglycin antibody

70R-5024 50 ug
EUR 467
Description: Rabbit polyclonal Serglycin antibody raised against the middle region of SRGN

SRGN ELISA Kit (Mouse) (OKCD08282)

OKCD08282 96 Wells
EUR 1001
Description: Description of target: Plays a role in formation of mast cell secretory granules and mediates storage of various compounds in secretory vesicles. Required for storage of some proteases in both connective tissue and mucosal mast cells and for storage of granzyme B in T-lymphocytes. Plays a role in localizing neutrophil elastase in azurophil granules of neutrophils. Mediates processing of MMP2. Plays a role in cytotoxic cell granule-mediated apoptosis by forming a complex with granzyme B which is delivered to cells by perforin to induce apoptosis. Regulates the secretion of TNF-alpha and may also regulate protease secretion. Inhibits bone mineralization.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 20.14pg/mL

SRGN ELISA Kit (Mouse) (OKEH05710)

OKEH05710 96 Wells
EUR 662
Description: Description of target: Plays a role in formation of mast cell secretory granules and mediates storage of various compounds in secretory vesicles. Required for storage of some proteases in both connective tissue and mucosal mast cells and for storage of granzyme B in T-lymphocytes. Plays a role in localizing neutrophil elastase in azurophil granules of neutrophils. Mediates processing of MMP2. Plays a role in cytotoxic cell granule-mediated apoptosis by forming a complex with granzyme B which is delivered to cells by perforin to induce apoptosis. Regulates the secretion of TNF-alpha and may also regulate protease secretion. Inhibits bone mineralization.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.318 ng/mL

SRGN ELISA Kit (Rat) (OKEH06242)

OKEH06242 96 Wells
EUR 662
Description: Description of target: Plays a role in formation of mast cell secretory granules and mediates storage of various compounds in secretory vesicles. Required for storage of some proteases in both connective tissue and mucosal mast cells and for storage of granzyme B in T-lymphocytes. Plays a role in localizing neutrophil elastase in azurophil granules of neutrophils. Mediates processing of MMP2. Plays a role in cytotoxic cell granule-mediated apoptosis by forming a complex with granzyme B which is delivered to cells by perforin to induce apoptosis. Regulates the secretion of TNF-alpha and may also regulate protease secretion. Inhibits bone mineralization.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.319 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SRGN Antibody

40117-100ul 100ul
EUR 252


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SRGN Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SRGN. Recognizes SRGN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

SRGN Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SRGN. Recognizes SRGN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

SRGN Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRGN. Recognizes SRGN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

SRGN Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SRGN. Recognizes SRGN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SRGN Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SRGN. Recognizes SRGN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

Serglycin, HEK Protein

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Serglycin Blocking Peptide

33R-8219 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SRGN antibody, catalog no. 70R-5024

Human SRGN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SRGN Recombinant Protein (Human)

RP030070 100 ug Ask for price

SRGN Recombinant Protein (Human)

RP030073 100 ug Ask for price

Human Serglycin Antibody (Biotin Conjugate)

33290-05121 150 ug
EUR 369

SRGN Conjugated Antibody

C40117 100ul
EUR 397

SRGN cloning plasmid

CSB-CL022664HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 477
  • Sequence: atgatgcagaagctactcaaatgcagtcggcttgtcctggctcttgccctcatcctggttctggaatcctcagttcaaggttatcctacgcagagagccaggtaccaatgggtgcgctgcaatccagacagtaattctgcaaactgccttgaagaaaaaggaccaatgttcgaact
  • Show more
Description: A cloning plasmid for the SRGN gene.

SRGN cloning plasmid

CSB-CL022664HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 165
  • Sequence: atgatgcagaagctactcaaatgcagtcggcttgtcctggctcttgccctcatcctggttctggaatcctcagttcaaggtaagactcaggagtcttgttccccagccatcttctctgtaagccctgtggtccatgcaagtcattatattcattttaaggcatag
Description: A cloning plasmid for the SRGN gene.

SRGN Rabbit pAb

A13340-100ul 100 ul
EUR 308

SRGN Rabbit pAb

A13340-200ul 200 ul
EUR 459

SRGN Rabbit pAb

A13340-20ul 20 ul
EUR 183

SRGN Rabbit pAb

A13340-50ul 50 ul
EUR 223

SRGN Rabbit pAb

A6951-100ul 100 ul
EUR 308

SRGN Rabbit pAb

A6951-200ul 200 ul
EUR 459

SRGN Rabbit pAb

A6951-20ul 20 ul
EUR 183

SRGN Rabbit pAb

A6951-50ul 50 ul
EUR 223

SRGN Polyclonal Antibody

42330-100ul 100ul
EUR 333


PVT13665 2 ug
EUR 391

Anti-SRGN antibody

STJ29031 100 µl
EUR 277
Description: This gene encodes a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydrolytic enzymes. This encoded protein was found to be associated with the macromolecular complex of granzymes and perforin, which may serve as a mediator of granule-mediated apoptosis. Two transcript variants, only one of them protein-coding, have been found for this gene.

Anti-SRGN antibody

STJ115303 100 µl
EUR 277
Description: This gene encodes a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydrolytic enzymes. This encoded protein was found to be associated with the macromolecular complex of granzymes and perforin, which may serve as a mediator of granule-mediated apoptosis. Two transcript variants, only one of them protein-coding, have been found for this gene.

Anti-SRGN (1D8)

YF-MA10715 100 ug
EUR 363
Description: Mouse monoclonal to SRGN

SRGN ORF Vector (Human) (pORF)

ORF010024 1.0 ug DNA
EUR 95

SRGN ORF Vector (Human) (pORF)

ORF010025 1.0 ug DNA
EUR 95

Human Serglycin AssayLite Antibody (FITC Conjugate)

33290-05141 150 ug
EUR 428

Human Serglycin AssayLite Antibody (RPE Conjugate)

33290-05151 150 ug
EUR 428

Human Serglycin AssayLite Antibody (APC Conjugate)

33290-05161 150 ug
EUR 428

Human Serglycin AssayLite Antibody (PerCP Conjugate)

33290-05171 150 ug
EUR 471

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Rat SRGN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SRGN protein (His tag)

80R-1996 100 ug
EUR 322
Description: Recombinant human SRGN protein (His tag)

Mouse SRGN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SRGN Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRGN. Recognizes SRGN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SRGN Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRGN. Recognizes SRGN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SRGN Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRGN. Recognizes SRGN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SRGN Recombinant Protein (Rat)

RP231041 100 ug Ask for price

SRGN Recombinant Protein (Mouse)

RP175406 100 ug Ask for price

SRGN sgRNA CRISPR Lentivector set (Human)

K2284901 3 x 1.0 ug
EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Human SRGN(Serglycin) ELISA Kit