Human SRGN(Serglycin) ELISA Kit

Human SRGN(Serglycin) ELISA Kit

Human Serglycin (SRGN) ELISA Kit
RD-SRGN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Serglycin (SRGN) ELISA Kit
RD-SRGN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Serglycin (SRGN) ELISA Kit
RDR-SRGN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Serglycin (SRGN) ELISA Kit
RDR-SRGN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Serglycin (SRGN) ELISA Kit
abx570659-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human SRGN/ Serglycin ELISA Kit
E2390Hu	Sunlong	1 Kit	EUR 571

Human SRGN(Serglycin) ELISA Kit
EH1207	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P10124 Alias: SRGN/Serglycin/Secretory granule proteoglycan core protein/Hematopoetic proteoglycan core protein/Platelet proteoglycan core protein/P.PG
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Serglycin, SRGN ELISA KIT
ELI-03491h	Lifescience Market	96 Tests	EUR 824

Human Serglycin (SRGN) ELISA Kit
20-abx153063	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Serglycin (SRGN) ELISA Kit
abx250462-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Serglycin(SRGN) ELISA kit
CSB-EL022664HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Serglycin (SRGN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Serglycin(SRGN) ELISA kit
1-CSB-EL022664HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Serglycin(SRGN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Serglycin (SRGN) ELISA Kit
SEC869Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Serglycin (SRGN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Serglycin (SRGN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Serglycin (SRGN) ELISA Kit
SEC869Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Serglycin (SRGN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Serglycin (SRGN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Serglycin (SRGN) ELISA Kit
SEC869Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Serglycin (SRGN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Serglycin (SRGN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Serglycin (SRGN) ELISA Kit
SEC869Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Serglycin (SRGN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Serglycin (SRGN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Serglycin (SRGN) ELISA Kit
4-SEC869Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Serglycin elisa. Alternative names of the recognized antigen: PRG PPG PRG1 proteoglycan 1, secretory granule
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Serglycin (SRGN) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Serglycin ELISA Kit (SRGN)
RK02336	Abclonal	96 Tests	EUR 521

Human Serglycin(SRGN)ELISA Kit
QY-E01413	Qayee Biotechnology	96T	EUR 374

Mouse Serglycin (SRGN) ELISA Kit
abx515044-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Serglycin (SRGN) ELISA Kit
abx515045-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Srgn/ Serglycin ELISA Kit
E1412Mo	Sunlong	1 Kit	EUR 571

Mouse Serglycin, Srgn ELISA KIT
ELI-03490m	Lifescience Market	96 Tests	EUR 865

Mouse Serglycin (SRGN) ELISA Kit
20-abx258994	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Serglycin (SRGN) ELISA Kit
SEC869Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Serglycin (SRGN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Serglycin (SRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Serglycin (SRGN) ELISA Kit
SEC869Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Serglycin (SRGN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Serglycin (SRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Serglycin (SRGN) ELISA Kit
SEC869Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Serglycin (SRGN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Serglycin (SRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Serglycin (SRGN) ELISA Kit
SEC869Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Serglycin (SRGN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Serglycin (SRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Serglycin (SRGN) ELISA Kit
4-SEC869Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Serglycin elisa. Alternative names of the recognized antigen: PRG PPG PRG1 proteoglycan 1, secretory granule
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Serglycin (SRGN) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Serglycin (SRGN) Antibody
abx145123-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Serglycin (SRGN) Antibody
20-abx132393	Abbexa	EUR 342.00 EUR 857.00 EUR 439.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Serglycin (SRGN) Antibody
20-abx100413	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Serglycin (SRGN) Antibody
20-abx005274	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Serglycin (SRGN) Antibody
20-abx320064	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Serglycin (SRGN) Antibody
20-abx321545	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Serglycin (SRGN) Protein
20-abx261514	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Serglycin (SRGN) Antibody
20-abx178361	Abbexa	EUR 425.00 EUR 119.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Serglycin (SRGN) Antibody
20-abx210581	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Serglycin (SRGN) Antibody
20-abx210582	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Recombinant Serglycin (SRGN)
4-RPC869Hu01	Cloud-Clone	EUR 377.76 EUR 204.00 EUR 1141.60 EUR 447.20 EUR 794.40 EUR 316.00 EUR 2704.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P10124 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 18.4kDa Isoelectric Point: 4.6
Description: Recombinant Human Serglycin expressed in: E.coli

Recombinant Serglycin (SRGN)
4-RPC869Mu01	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P13609 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 15.4kDa Isoelectric Point: 4.6
Description: Recombinant Mouse Serglycin expressed in: E.coli

ELISA kit for Human SRGN (Serglycin)
E-EL-H2508	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's SRGN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human SRGN. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human SRGN (Serglycin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human SRGN (Serglycin)
ELK3094	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Serglycin (SRGN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Serglycin (SRGN). Show more
Description: A sandwich ELISA kit for detection of Serglycin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Serglycin (SRGN)
KTE60357-48T	Abbkine	48T	EUR 332
Serglycin is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydroly Show more
Description: Quantitative sandwich ELISA for measuring Human Serglycin (SRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Serglycin (SRGN)
KTE60357-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Serglycin is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydroly Show more
Description: Quantitative sandwich ELISA for measuring Human Serglycin (SRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Serglycin (SRGN)
KTE60357-96T	Abbkine	96T	EUR 539
Serglycin is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydroly Show more
Description: Quantitative sandwich ELISA for measuring Human Serglycin (SRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Serglycin (SRGN) CLIA Kit
20-abx493943	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Serglycin (SRGN) Protein
20-abx652206	Abbexa	EUR 537.00 EUR 244.00 EUR 1553.00 EUR 634.00 EUR 398.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ELISA kit for Mouse SRGN (Serglycin)
ELK7758	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Serglycin (SRGN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Serglycin (SRGN). Show more
Description: A sandwich ELISA kit for detection of Serglycin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat Serglycin (SRGN)
KTE100131-48T	Abbkine	48T	EUR 332
Serglycin is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydroly Show more
Description: Quantitative sandwich ELISA for measuring Rat Serglycin (SRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Serglycin (SRGN)
KTE100131-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Serglycin is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydroly Show more
Description: Quantitative sandwich ELISA for measuring Rat Serglycin (SRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Serglycin (SRGN)
KTE100131-96T	Abbkine	96T	EUR 539
Serglycin is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydroly Show more
Description: Quantitative sandwich ELISA for measuring Rat Serglycin (SRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Serglycin (SRGN)
KTE70254-48T	Abbkine	48T	EUR 332
Serglycin is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydroly Show more
Description: Quantitative sandwich ELISA for measuring Mouse Serglycin (SRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Serglycin (SRGN)
KTE70254-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Serglycin is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydroly Show more
Description: Quantitative sandwich ELISA for measuring Mouse Serglycin (SRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Serglycin (SRGN)
KTE70254-96T	Abbkine	96T	EUR 539
Serglycin is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydroly Show more
Description: Quantitative sandwich ELISA for measuring Mouse Serglycin (SRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Serglycin (SRGN) CLIA Kit
20-abx496459	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Serglycin (SRGN) Protein
20-abx069038	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Serglycin (SRGN) Antibody (FITC)
20-abx273892	Abbexa	EUR 495.00 EUR 258.00 EUR 1455.00 EUR 676.00 EUR 398.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Serglycin (SRGN) Antibody Pair
20-abx370705	Abbexa	EUR 1650.00 EUR 1052.00	10 × 96 tests 5 × 96 tests
Shipped within 5-15 working days.

Serglycin (SRGN) Antibody (Biotin)
20-abx272896	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

SRGN Serglycin Human Recombinant Protein
PROTP10124	BosterBio	Regular: 20ug	EUR 317
Description: SRGN Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 156 amino acids (28-158) and having a molecular mass of 17.4 kDa (Molecular weight on SDS-PAGE will appear higher).;SRGN is fused to a 25 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Serglycin (SRGN) Monoclonal Antibody (Human)
4-MAC869Hu22	Cloud-Clone	EUR 255.00 EUR 2642.00 EUR 655.00 EUR 322.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Serglycin (SRGN)

Serglycin (SRGN) Polyclonal Antibody (Mouse)
4-PAC869Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SRGN (Ala28~Ile152) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serglycin (SRGN)

Serglycin (SRGN) Monoclonal Antibody (Human), APC
4-MAC869Hu22-APC	Cloud-Clone	EUR 358.00 EUR 3455.00 EUR 957.00 EUR 458.00 EUR 224.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Serglycin (SRGN). This antibody is labeled with APC.

Serglycin (SRGN) Monoclonal Antibody (Human), Biotinylated
4-MAC869Hu22-Biotin	Cloud-Clone	EUR 320.00 EUR 2592.00 EUR 760.00 EUR 394.00 EUR 223.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Serglycin (SRGN). This antibody is labeled with Biotin.

Serglycin (SRGN) Monoclonal Antibody (Human), Cy3
4-MAC869Hu22-Cy3	Cloud-Clone	EUR 435.00 EUR 4565.00 EUR 1235.00 EUR 569.00 EUR 258.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Serglycin (SRGN). This antibody is labeled with Cy3.

Serglycin (SRGN) Monoclonal Antibody (Human), FITC
4-MAC869Hu22-FITC	Cloud-Clone	EUR 306.00 EUR 2784.00 EUR 786.00 EUR 386.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Serglycin (SRGN). This antibody is labeled with FITC.

Serglycin (SRGN) Monoclonal Antibody (Human), HRP
4-MAC869Hu22-HRP	Cloud-Clone	EUR 327.00 EUR 3011.00 EUR 846.00 EUR 413.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Serglycin (SRGN). This antibody is labeled with HRP.

Serglycin (SRGN) Monoclonal Antibody (Human), PE
4-MAC869Hu22-PE	Cloud-Clone	EUR 306.00 EUR 2784.00 EUR 786.00 EUR 386.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Serglycin (SRGN). This antibody is labeled with PE.

SRGN Human, Serglycin Human Recombinant Protein, HEK
PROTP10124-1	BosterBio	Regular: 10ug	EUR 317
Description: Serglycin Human Recombinant produced in HEK cells is a single, glycosylated, polypeptide chain (Tyr28-Leu158) containing a total of 137 amino acids, having a calculated molecular mass of 15.5kDa and fused to a 6 aa His tag at C-Terminus.

Serglycin (SRGN) Monoclonal Antibody (Human), APC-Cy7
4-MAC869Hu22-APC-Cy7	Cloud-Clone	EUR 596.00 EUR 6790.00 EUR 1795.00 EUR 796.00 EUR 329.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Serglycin (SRGN). This antibody is labeled with APC-Cy7.

Serglycin (SRGN) Polyclonal Antibody (Mouse), APC
4-PAC869Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SRGN (Ala28~Ile152) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serglycin (SRGN). This antibody is labeled with APC.

Serglycin (SRGN) Polyclonal Antibody (Mouse), Biotinylated
4-PAC869Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SRGN (Ala28~Ile152) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serglycin (SRGN). This antibody is labeled with Biotin.

Serglycin (SRGN) Polyclonal Antibody (Mouse), Cy3
4-PAC869Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SRGN (Ala28~Ile152) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serglycin (SRGN). This antibody is labeled with Cy3.

Serglycin (SRGN) Polyclonal Antibody (Mouse), FITC
4-PAC869Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SRGN (Ala28~Ile152) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serglycin (SRGN). This antibody is labeled with FITC.

Serglycin (SRGN) Polyclonal Antibody (Mouse), HRP
4-PAC869Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SRGN (Ala28~Ile152) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serglycin (SRGN). This antibody is labeled with HRP.

Serglycin (SRGN) Polyclonal Antibody (Mouse), PE
4-PAC869Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SRGN (Ala28~Ile152) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serglycin (SRGN). This antibody is labeled with PE.

Serglycin (SRGN) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC869Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SRGN (Ala28~Ile152) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serglycin (SRGN). This antibody is labeled with APC-Cy7.

Srgn/ Rat Srgn ELISA Kit
ELI-03489r	Lifescience Market	96 Tests	EUR 886

Human SRGN ELISA Kit
ELA-E1072h	Lifescience Market	96 Tests	EUR 824

SRGN ELISA KIT|Human
EF002715	Lifescience Market	96 Tests	EUR 689

ELISA kit for Human Serglycin
EK2690	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Serglycin in samples from serum, plasma, tissue homogenates and other biological fluids.

SRGN ELISA Kit (Human) (OKAN05303)
OKAN05303	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydrolytic enzymes. This encoded protein was found to be associated with the macromolecular complex of granzymes and perforin, which may serve as a mediator of granule-mediated apoptosis. Two transcript variants, only one of them protein-coding, have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.059 ng/mL

SRGN ELISA Kit (Human) (OKCD08281)
OKCD08281	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: SRGN is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydrolytic enzymes. SRGN was found to be associated with the macromolecular complex of granzymes and perforin, which may serve as a mediator of granule-mediated apoptosis.This gene encodes a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydrolytic enzymes. This encoded protein was found to be associated with the macromolecular complex of granzymes and perforin, which may serve as a mediator of granule-mediated apoptosis. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

SRGN ELISA Kit (Human) (OKEH00741)
OKEH00741	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This gene encodes a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydrolytic enzymes. This encoded protein was found to be associated with the macromolecular complex of granzymes and perforin, which may serve as a mediator of granule-mediated apoptosis. Two transcript variants, only one of them protein-coding, have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.086 ng/mL

Human Serglycin Antibody
33290-05111	AssayPro	150 ug	EUR 261

Serglycin antibody
70R-5024	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Serglycin antibody raised against the middle region of SRGN

SRGN ELISA Kit (Mouse) (OKCD08282)
OKCD08282	Aviva Systems Biology	96 Wells	EUR 1001
Description: Description of target: Plays a role in formation of mast cell secretory granules and mediates storage of various compounds in secretory vesicles. Required for storage of some proteases in both connective tissue and mucosal mast cells and for storage of granzyme B in T-lymphocytes. Plays a role in localizing neutrophil elastase in azurophil granules of neutrophils. Mediates processing of MMP2. Plays a role in cytotoxic cell granule-mediated apoptosis by forming a complex with granzyme B which is delivered to cells by perforin to induce apoptosis. Regulates the secretion of TNF-alpha and may also regulate protease secretion. Inhibits bone mineralization.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 20.14pg/mL

SRGN ELISA Kit (Mouse) (OKEH05710)
OKEH05710	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Plays a role in formation of mast cell secretory granules and mediates storage of various compounds in secretory vesicles. Required for storage of some proteases in both connective tissue and mucosal mast cells and for storage of granzyme B in T-lymphocytes. Plays a role in localizing neutrophil elastase in azurophil granules of neutrophils. Mediates processing of MMP2. Plays a role in cytotoxic cell granule-mediated apoptosis by forming a complex with granzyme B which is delivered to cells by perforin to induce apoptosis. Regulates the secretion of TNF-alpha and may also regulate protease secretion. Inhibits bone mineralization.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.318 ng/mL

SRGN ELISA Kit (Rat) (OKEH06242)
OKEH06242	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Plays a role in formation of mast cell secretory granules and mediates storage of various compounds in secretory vesicles. Required for storage of some proteases in both connective tissue and mucosal mast cells and for storage of granzyme B in T-lymphocytes. Plays a role in localizing neutrophil elastase in azurophil granules of neutrophils. Mediates processing of MMP2. Plays a role in cytotoxic cell granule-mediated apoptosis by forming a complex with granzyme B which is delivered to cells by perforin to induce apoptosis. Regulates the secretion of TNF-alpha and may also regulate protease secretion. Inhibits bone mineralization.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.319 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

SRGN siRNA
20-abx905280	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SRGN Antibody
40117-100ul	SAB	100ul	EUR 252

SRGN siRNA
20-abx935156	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SRGN siRNA
20-abx935157	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SRGN Antibody
1-CSB-PA287152	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SRGN. Recognizes SRGN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

SRGN Antibody
1-CSB-PA181261	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SRGN. Recognizes SRGN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

SRGN Antibody
1-CSB-PA022664EA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRGN. Recognizes SRGN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

SRGN Antibody
1-CSB-PA022664ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SRGN. Recognizes SRGN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SRGN Antibody
1-CSB-PA022664ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SRGN. Recognizes SRGN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

Serglycin, HEK Protein
20-abx262807	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

Serglycin Blocking Peptide
33R-8219	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SRGN antibody, catalog no. 70R-5024

Human SRGN shRNA Plasmid
20-abx953728	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SRGN Recombinant Protein (Human)
RP030070	ABM	100 ug	Ask for price

SRGN Recombinant Protein (Human)
RP030073	ABM	100 ug	Ask for price

Human Serglycin Antibody (Biotin Conjugate)
33290-05121	AssayPro	150 ug	EUR 369

SRGN Conjugated Antibody
C40117	SAB	100ul	EUR 397

SRGN cloning plasmid
CSB-CL022664HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 477 Sequence: atgatgcagaagctactcaaatgcagtcggcttgtcctggctcttgccctcatcctggttctggaatcctcagttcaaggttatcctacgcagagagccaggtaccaatgggtgcgctgcaatccagacagtaattctgcaaactgccttgaagaaaaaggaccaatgttcgaact Show more
Description: A cloning plasmid for the SRGN gene.

SRGN cloning plasmid
CSB-CL022664HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 165 Sequence: atgatgcagaagctactcaaatgcagtcggcttgtcctggctcttgccctcatcctggttctggaatcctcagttcaaggtaagactcaggagtcttgttccccagccatcttctctgtaagccctgtggtccatgcaagtcattatattcattttaaggcatag
Description: A cloning plasmid for the SRGN gene.

SRGN Rabbit pAb
A13340-100ul	Abclonal	100 ul	EUR 308

SRGN Rabbit pAb
A13340-200ul	Abclonal	200 ul	EUR 459

SRGN Rabbit pAb
A13340-20ul	Abclonal	20 ul	EUR 183

SRGN Rabbit pAb
A13340-50ul	Abclonal	50 ul	EUR 223

SRGN Rabbit pAb
A6951-100ul	Abclonal	100 ul	EUR 308

SRGN Rabbit pAb
A6951-200ul	Abclonal	200 ul	EUR 459

SRGN Rabbit pAb
A6951-20ul	Abclonal	20 ul	EUR 183

SRGN Rabbit pAb
A6951-50ul	Abclonal	50 ul	EUR 223

SRGN Polyclonal Antibody
42330-100ul	SAB	100ul	EUR 333

pCMV-SPORT6-SRGN
PVT13665	Lifescience Market	2 ug	EUR 391

Anti-SRGN antibody
STJ29031	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydrolytic enzymes. This encoded protein was found to be associated with the macromolecular complex of granzymes and perforin, which may serve as a mediator of granule-mediated apoptosis. Two transcript variants, only one of them protein-coding, have been found for this gene.

Anti-SRGN antibody
STJ115303	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydrolytic enzymes. This encoded protein was found to be associated with the macromolecular complex of granzymes and perforin, which may serve as a mediator of granule-mediated apoptosis. Two transcript variants, only one of them protein-coding, have been found for this gene.

Anti-SRGN (1D8)
YF-MA10715	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SRGN

SRGN ORF Vector (Human) (pORF)
ORF010024	ABM	1.0 ug DNA	EUR 95

SRGN ORF Vector (Human) (pORF)
ORF010025	ABM	1.0 ug DNA	EUR 95

Human Serglycin AssayLite Antibody (FITC Conjugate)
33290-05141	AssayPro	150 ug	EUR 428

Human Serglycin AssayLite Antibody (RPE Conjugate)
33290-05151	AssayPro	150 ug	EUR 428

Human Serglycin AssayLite Antibody (APC Conjugate)
33290-05161	AssayPro	150 ug	EUR 428

Human Serglycin AssayLite Antibody (PerCP Conjugate)
33290-05171	AssayPro	150 ug	EUR 471

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Rat SRGN shRNA Plasmid
20-abx985877	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SRGN protein (His tag)
80R-1996	Fitzgerald	100 ug	EUR 322
Description: Recombinant human SRGN protein (His tag)

Mouse SRGN shRNA Plasmid
20-abx972188	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SRGN Antibody, HRP conjugated
1-CSB-PA022664EB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRGN. Recognizes SRGN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SRGN Antibody, FITC conjugated
1-CSB-PA022664EC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRGN. Recognizes SRGN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SRGN Antibody, Biotin conjugated
1-CSB-PA022664ED01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRGN. Recognizes SRGN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SRGN Recombinant Protein (Rat)
RP231041	ABM	100 ug	Ask for price

SRGN Recombinant Protein (Mouse)
RP175406	ABM	100 ug	Ask for price

SRGN sgRNA CRISPR Lentivector set (Human)
K2284901	ABM	3 x 1.0 ug	EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Human SRGN(Serglycin) ELISA Kit