Human SRGN(Serglycin) ELISA Kit
Human Serglycin (SRGN) ELISA Kit |
RD-SRGN-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Serglycin (SRGN) ELISA Kit |
RD-SRGN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Serglycin (SRGN) ELISA Kit |
RDR-SRGN-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Serglycin (SRGN) ELISA Kit |
RDR-SRGN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Serglycin (SRGN) ELISA Kit |
abx570659-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human SRGN/ Serglycin ELISA Kit |
E2390Hu |
Sunlong |
1 Kit |
EUR 571 |
Human SRGN(Serglycin) ELISA Kit |
EH1207 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P10124
- Alias: SRGN/Serglycin/Secretory granule proteoglycan core protein/Hematopoetic proteoglycan core protein/Platelet proteoglycan core protein/P.PG
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Serglycin (SRGN) ELISA Kit |
20-abx153063 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Serglycin (SRGN) ELISA Kit |
abx250462-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Serglycin(SRGN) ELISA kit |
CSB-EL022664HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Serglycin (SRGN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Serglycin(SRGN) ELISA kit |
1-CSB-EL022664HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Serglycin(SRGN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Serglycin (SRGN) ELISA Kit |
SEC869Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Serglycin (SRGN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Serglycin (SRGN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Serglycin (SRGN) ELISA Kit |
SEC869Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Serglycin (SRGN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Serglycin (SRGN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Serglycin (SRGN) ELISA Kit |
SEC869Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Serglycin (SRGN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Serglycin (SRGN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Serglycin (SRGN) ELISA Kit |
SEC869Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Serglycin (SRGN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Serglycin (SRGN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Serglycin (SRGN) ELISA Kit |
4-SEC869Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Serglycin elisa. Alternative names of the recognized antigen: PRG
- PPG
- PRG1
- proteoglycan 1, secretory granule
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Serglycin (SRGN) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Serglycin ELISA Kit (SRGN) |
RK02336 |
Abclonal |
96 Tests |
EUR 521 |
Mouse Serglycin (SRGN) ELISA Kit |
abx515044-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Serglycin (SRGN) ELISA Kit |
abx515045-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Srgn/ Serglycin ELISA Kit |
E1412Mo |
Sunlong |
1 Kit |
EUR 571 |
Mouse Serglycin (SRGN) ELISA Kit |
20-abx258994 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Serglycin (SRGN) ELISA Kit |
SEC869Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Serglycin (SRGN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Serglycin (SRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Serglycin (SRGN) ELISA Kit |
SEC869Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Serglycin (SRGN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Serglycin (SRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Serglycin (SRGN) ELISA Kit |
SEC869Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Serglycin (SRGN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Serglycin (SRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Serglycin (SRGN) ELISA Kit |
SEC869Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Serglycin (SRGN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Serglycin (SRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Serglycin (SRGN) ELISA Kit |
4-SEC869Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Serglycin elisa. Alternative names of the recognized antigen: PRG
- PPG
- PRG1
- proteoglycan 1, secretory granule
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Serglycin (SRGN) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Serglycin (SRGN) Antibody |
abx145123-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Serglycin (SRGN) Antibody |
20-abx132393 |
Abbexa |
-
EUR 342.00
-
EUR 857.00
-
EUR 439.00
-
EUR 154.00
-
EUR 258.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Serglycin (SRGN) Antibody |
20-abx100413 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Serglycin (SRGN) Antibody |
20-abx005274 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Serglycin (SRGN) Antibody |
20-abx320064 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Serglycin (SRGN) Antibody |
20-abx321545 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Serglycin (SRGN) Protein |
20-abx261514 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Serglycin (SRGN) Antibody |
20-abx178361 |
Abbexa |
-
EUR 425.00
-
EUR 119.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Serglycin (SRGN) Antibody |
20-abx210581 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Serglycin (SRGN) Antibody |
20-abx210582 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Recombinant Serglycin (SRGN) |
4-RPC869Hu01 |
Cloud-Clone |
-
EUR 377.76
-
EUR 204.00
-
EUR 1141.60
-
EUR 447.20
-
EUR 794.40
-
EUR 316.00
-
EUR 2704.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P10124
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 18.4kDa
- Isoelectric Point: 4.6
|
Description: Recombinant Human Serglycin expressed in: E.coli |
Recombinant Serglycin (SRGN) |
4-RPC869Mu01 |
Cloud-Clone |
-
EUR 413.60
-
EUR 214.00
-
EUR 1276.00
-
EUR 492.00
-
EUR 884.00
-
EUR 340.00
-
EUR 3040.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P13609
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 15.4kDa
- Isoelectric Point: 4.6
|
Description: Recombinant Mouse Serglycin expressed in: E.coli |
ELISA kit for Human SRGN (Serglycin) |
E-EL-H2508 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's SRGN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human SRGN. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human SRGN (Serglycin) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human SRGN (Serglycin) |
ELK3094 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Serglycin (SRGN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Serglycin (SRGN).
- Show more
|
Description: A sandwich ELISA kit for detection of Serglycin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Serglycin (SRGN) |
KTE60357-48T |
Abbkine |
48T |
EUR 332 |
- Serglycin is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydroly
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Serglycin (SRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Serglycin (SRGN) |
KTE60357-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Serglycin is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydroly
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Serglycin (SRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Serglycin (SRGN) |
KTE60357-96T |
Abbkine |
96T |
EUR 539 |
- Serglycin is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydroly
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Serglycin (SRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Serglycin (SRGN) CLIA Kit |
20-abx493943 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Serglycin (SRGN) Protein |
20-abx652206 |
Abbexa |
-
EUR 537.00
-
EUR 244.00
-
EUR 1553.00
-
EUR 634.00
-
EUR 398.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
ELISA kit for Mouse SRGN (Serglycin) |
ELK7758 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Serglycin (SRGN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Serglycin (SRGN).
- Show more
|
Description: A sandwich ELISA kit for detection of Serglycin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Rat Serglycin (SRGN) |
KTE100131-48T |
Abbkine |
48T |
EUR 332 |
- Serglycin is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydroly
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Serglycin (SRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Serglycin (SRGN) |
KTE100131-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Serglycin is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydroly
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Serglycin (SRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Serglycin (SRGN) |
KTE100131-96T |
Abbkine |
96T |
EUR 539 |
- Serglycin is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydroly
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Serglycin (SRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Serglycin (SRGN) |
KTE70254-48T |
Abbkine |
48T |
EUR 332 |
- Serglycin is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydroly
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Serglycin (SRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Serglycin (SRGN) |
KTE70254-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Serglycin is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydroly
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Serglycin (SRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Serglycin (SRGN) |
KTE70254-96T |
Abbkine |
96T |
EUR 539 |
- Serglycin is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydroly
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Serglycin (SRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Mouse Serglycin (SRGN) CLIA Kit |
20-abx496459 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Serglycin (SRGN) Protein |
20-abx069038 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Serglycin (SRGN) Antibody (FITC) |
20-abx273892 |
Abbexa |
-
EUR 495.00
-
EUR 258.00
-
EUR 1455.00
-
EUR 676.00
-
EUR 398.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Serglycin (SRGN) Antibody Pair |
20-abx370705 |
Abbexa |
|
-
10 × 96 tests
-
5 × 96 tests
|
- Shipped within 5-15 working days.
|
Serglycin (SRGN) Antibody (Biotin) |
20-abx272896 |
Abbexa |
-
EUR 467.00
-
EUR 244.00
-
EUR 1344.00
-
EUR 634.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
SRGN Serglycin Human Recombinant Protein |
PROTP10124 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: SRGN Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 156 amino acids (28-158) and having a molecular mass of 17.4 kDa (Molecular weight on SDS-PAGE will appear higher).;SRGN is fused to a 25 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Serglycin (SRGN) Monoclonal Antibody (Human) |
4-MAC869Hu22 |
Cloud-Clone |
-
EUR 255.00
-
EUR 2642.00
-
EUR 655.00
-
EUR 322.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Serglycin (SRGN) |
Serglycin (SRGN) Polyclonal Antibody (Mouse) |
4-PAC869Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SRGN (Ala28~Ile152)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Serglycin (SRGN) |
Serglycin (SRGN) Monoclonal Antibody (Human), APC |
4-MAC869Hu22-APC |
Cloud-Clone |
-
EUR 358.00
-
EUR 3455.00
-
EUR 957.00
-
EUR 458.00
-
EUR 224.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Serglycin (SRGN). This antibody is labeled with APC. |
Serglycin (SRGN) Monoclonal Antibody (Human), Biotinylated |
4-MAC869Hu22-Biotin |
Cloud-Clone |
-
EUR 320.00
-
EUR 2592.00
-
EUR 760.00
-
EUR 394.00
-
EUR 223.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Serglycin (SRGN). This antibody is labeled with Biotin. |
Serglycin (SRGN) Monoclonal Antibody (Human), Cy3 |
4-MAC869Hu22-Cy3 |
Cloud-Clone |
-
EUR 435.00
-
EUR 4565.00
-
EUR 1235.00
-
EUR 569.00
-
EUR 258.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Serglycin (SRGN). This antibody is labeled with Cy3. |
Serglycin (SRGN) Monoclonal Antibody (Human), FITC |
4-MAC869Hu22-FITC |
Cloud-Clone |
-
EUR 306.00
-
EUR 2784.00
-
EUR 786.00
-
EUR 386.00
-
EUR 199.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Serglycin (SRGN). This antibody is labeled with FITC. |
Serglycin (SRGN) Monoclonal Antibody (Human), HRP |
4-MAC869Hu22-HRP |
Cloud-Clone |
-
EUR 327.00
-
EUR 3011.00
-
EUR 846.00
-
EUR 413.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Serglycin (SRGN). This antibody is labeled with HRP. |
Serglycin (SRGN) Monoclonal Antibody (Human), PE |
4-MAC869Hu22-PE |
Cloud-Clone |
-
EUR 306.00
-
EUR 2784.00
-
EUR 786.00
-
EUR 386.00
-
EUR 199.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Serglycin (SRGN). This antibody is labeled with PE. |
SRGN Human, Serglycin Human Recombinant Protein, HEK |
PROTP10124-1 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: Serglycin Human Recombinant produced in HEK cells is a single, glycosylated, polypeptide chain (Tyr28-Leu158) containing a total of 137 amino acids, having a calculated molecular mass of 15.5kDa and fused to a 6 aa His tag at C-Terminus. |
Serglycin (SRGN) Monoclonal Antibody (Human), APC-Cy7 |
4-MAC869Hu22-APC-Cy7 |
Cloud-Clone |
-
EUR 596.00
-
EUR 6790.00
-
EUR 1795.00
-
EUR 796.00
-
EUR 329.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Serglycin (SRGN). This antibody is labeled with APC-Cy7. |
Serglycin (SRGN) Polyclonal Antibody (Mouse), APC |
4-PAC869Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SRGN (Ala28~Ile152)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Serglycin (SRGN). This antibody is labeled with APC. |
Serglycin (SRGN) Polyclonal Antibody (Mouse), Biotinylated |
4-PAC869Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SRGN (Ala28~Ile152)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Serglycin (SRGN). This antibody is labeled with Biotin. |
Serglycin (SRGN) Polyclonal Antibody (Mouse), Cy3 |
4-PAC869Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SRGN (Ala28~Ile152)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Serglycin (SRGN). This antibody is labeled with Cy3. |
Serglycin (SRGN) Polyclonal Antibody (Mouse), FITC |
4-PAC869Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SRGN (Ala28~Ile152)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Serglycin (SRGN). This antibody is labeled with FITC. |
Serglycin (SRGN) Polyclonal Antibody (Mouse), HRP |
4-PAC869Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SRGN (Ala28~Ile152)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Serglycin (SRGN). This antibody is labeled with HRP. |
Serglycin (SRGN) Polyclonal Antibody (Mouse), PE |
4-PAC869Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SRGN (Ala28~Ile152)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Serglycin (SRGN). This antibody is labeled with PE. |
Serglycin (SRGN) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAC869Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SRGN (Ala28~Ile152)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Serglycin (SRGN). This antibody is labeled with APC-Cy7. |
ELISA kit for Human Serglycin |
EK2690 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Serglycin in samples from serum, plasma, tissue homogenates and other biological fluids. |
SRGN ELISA Kit (Human) (OKAN05303) |
OKAN05303 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydrolytic enzymes. This encoded protein was found to be associated with the macromolecular complex of granzymes and perforin, which may serve as a mediator of granule-mediated apoptosis. Two transcript variants, only one of them protein-coding, have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.059 ng/mL |
SRGN ELISA Kit (Human) (OKCD08281) |
OKCD08281 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: SRGN is a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydrolytic enzymes. SRGN was found to be associated with the macromolecular complex of granzymes and perforin, which may serve as a mediator of granule-mediated apoptosis.This gene encodes a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydrolytic enzymes. This encoded protein was found to be associated with the macromolecular complex of granzymes and perforin, which may serve as a mediator of granule-mediated apoptosis. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL |
SRGN ELISA Kit (Human) (OKEH00741) |
OKEH00741 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: This gene encodes a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydrolytic enzymes. This encoded protein was found to be associated with the macromolecular complex of granzymes and perforin, which may serve as a mediator of granule-mediated apoptosis. Two transcript variants, only one of them protein-coding, have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.086 ng/mL |
Human Serglycin Antibody |
33290-05111 |
AssayPro |
150 ug |
EUR 261 |
Serglycin antibody |
70R-5024 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal Serglycin antibody raised against the middle region of SRGN |
SRGN ELISA Kit (Mouse) (OKCD08282) |
OKCD08282 |
Aviva Systems Biology |
96 Wells |
EUR 1001 |
Description: Description of target: Plays a role in formation of mast cell secretory granules and mediates storage of various compounds in secretory vesicles. Required for storage of some proteases in both connective tissue and mucosal mast cells and for storage of granzyme B in T-lymphocytes. Plays a role in localizing neutrophil elastase in azurophil granules of neutrophils. Mediates processing of MMP2. Plays a role in cytotoxic cell granule-mediated apoptosis by forming a complex with granzyme B which is delivered to cells by perforin to induce apoptosis. Regulates the secretion of TNF-alpha and may also regulate protease secretion. Inhibits bone mineralization.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 20.14pg/mL |
SRGN ELISA Kit (Mouse) (OKEH05710) |
OKEH05710 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Plays a role in formation of mast cell secretory granules and mediates storage of various compounds in secretory vesicles. Required for storage of some proteases in both connective tissue and mucosal mast cells and for storage of granzyme B in T-lymphocytes. Plays a role in localizing neutrophil elastase in azurophil granules of neutrophils. Mediates processing of MMP2. Plays a role in cytotoxic cell granule-mediated apoptosis by forming a complex with granzyme B which is delivered to cells by perforin to induce apoptosis. Regulates the secretion of TNF-alpha and may also regulate protease secretion. Inhibits bone mineralization.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.318 ng/mL |
SRGN ELISA Kit (Rat) (OKEH06242) |
OKEH06242 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Plays a role in formation of mast cell secretory granules and mediates storage of various compounds in secretory vesicles. Required for storage of some proteases in both connective tissue and mucosal mast cells and for storage of granzyme B in T-lymphocytes. Plays a role in localizing neutrophil elastase in azurophil granules of neutrophils. Mediates processing of MMP2. Plays a role in cytotoxic cell granule-mediated apoptosis by forming a complex with granzyme B which is delivered to cells by perforin to induce apoptosis. Regulates the secretion of TNF-alpha and may also regulate protease secretion. Inhibits bone mineralization.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.319 ng/mL |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
SRGN siRNA |
20-abx905280 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SRGN Antibody |
40117-100ul |
SAB |
100ul |
EUR 252 |
SRGN siRNA |
20-abx935156 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SRGN siRNA |
20-abx935157 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SRGN Antibody |
1-CSB-PA287152 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against SRGN. Recognizes SRGN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
SRGN Antibody |
1-CSB-PA181261 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against SRGN. Recognizes SRGN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
SRGN Antibody |
1-CSB-PA022664EA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SRGN. Recognizes SRGN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500 |
SRGN Antibody |
1-CSB-PA022664ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against SRGN. Recognizes SRGN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
SRGN Antibody |
1-CSB-PA022664ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against SRGN. Recognizes SRGN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
Serglycin, HEK Protein |
20-abx262807 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Serglycin Blocking Peptide |
33R-8219 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SRGN antibody, catalog no. 70R-5024 |
Human SRGN shRNA Plasmid |
20-abx953728 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SRGN Recombinant Protein (Human) |
RP030070 |
ABM |
100 ug |
Ask for price |
SRGN Recombinant Protein (Human) |
RP030073 |
ABM |
100 ug |
Ask for price |
Human Serglycin Antibody (Biotin Conjugate) |
33290-05121 |
AssayPro |
150 ug |
EUR 369 |
SRGN Conjugated Antibody |
C40117 |
SAB |
100ul |
EUR 397 |
SRGN cloning plasmid |
CSB-CL022664HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 477
- Sequence: atgatgcagaagctactcaaatgcagtcggcttgtcctggctcttgccctcatcctggttctggaatcctcagttcaaggttatcctacgcagagagccaggtaccaatgggtgcgctgcaatccagacagtaattctgcaaactgccttgaagaaaaaggaccaatgttcgaact
- Show more
|
Description: A cloning plasmid for the SRGN gene. |
SRGN cloning plasmid |
CSB-CL022664HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 165
- Sequence: atgatgcagaagctactcaaatgcagtcggcttgtcctggctcttgccctcatcctggttctggaatcctcagttcaaggtaagactcaggagtcttgttccccagccatcttctctgtaagccctgtggtccatgcaagtcattatattcattttaaggcatag
|
Description: A cloning plasmid for the SRGN gene. |
SRGN Rabbit pAb |
A13340-100ul |
Abclonal |
100 ul |
EUR 308 |
SRGN Rabbit pAb |
A13340-200ul |
Abclonal |
200 ul |
EUR 459 |
SRGN Rabbit pAb |
A13340-20ul |
Abclonal |
20 ul |
EUR 183 |
SRGN Rabbit pAb |
A13340-50ul |
Abclonal |
50 ul |
EUR 223 |
SRGN Rabbit pAb |
A6951-100ul |
Abclonal |
100 ul |
EUR 308 |
SRGN Rabbit pAb |
A6951-200ul |
Abclonal |
200 ul |
EUR 459 |
SRGN Rabbit pAb |
A6951-20ul |
Abclonal |
20 ul |
EUR 183 |
SRGN Rabbit pAb |
A6951-50ul |
Abclonal |
50 ul |
EUR 223 |
SRGN Polyclonal Antibody |
42330-100ul |
SAB |
100ul |
EUR 333 |
Anti-SRGN antibody |
STJ29031 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydrolytic enzymes. This encoded protein was found to be associated with the macromolecular complex of granzymes and perforin, which may serve as a mediator of granule-mediated apoptosis. Two transcript variants, only one of them protein-coding, have been found for this gene. |
Anti-SRGN antibody |
STJ115303 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydrolytic enzymes. This encoded protein was found to be associated with the macromolecular complex of granzymes and perforin, which may serve as a mediator of granule-mediated apoptosis. Two transcript variants, only one of them protein-coding, have been found for this gene. |
Anti-SRGN (1D8) |
YF-MA10715 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to SRGN |
SRGN ORF Vector (Human) (pORF) |
ORF010024 |
ABM |
1.0 ug DNA |
EUR 95 |
SRGN ORF Vector (Human) (pORF) |
ORF010025 |
ABM |
1.0 ug DNA |
EUR 95 |
Human Serglycin AssayLite Antibody (FITC Conjugate) |
33290-05141 |
AssayPro |
150 ug |
EUR 428 |
Human Serglycin AssayLite Antibody (RPE Conjugate) |
33290-05151 |
AssayPro |
150 ug |
EUR 428 |
Human Serglycin AssayLite Antibody (APC Conjugate) |
33290-05161 |
AssayPro |
150 ug |
EUR 428 |
Human Serglycin AssayLite Antibody (PerCP Conjugate) |
33290-05171 |
AssayPro |
150 ug |
EUR 471 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Rat SRGN shRNA Plasmid |
20-abx985877 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SRGN protein (His tag) |
80R-1996 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Recombinant human SRGN protein (His tag) |
Mouse SRGN shRNA Plasmid |
20-abx972188 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SRGN Antibody, HRP conjugated |
1-CSB-PA022664EB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SRGN. Recognizes SRGN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
SRGN Antibody, FITC conjugated |
1-CSB-PA022664EC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SRGN. Recognizes SRGN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
SRGN Antibody, Biotin conjugated |
1-CSB-PA022664ED01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SRGN. Recognizes SRGN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
SRGN Recombinant Protein (Rat) |
RP231041 |
ABM |
100 ug |
Ask for price |
SRGN Recombinant Protein (Mouse) |
RP175406 |
ABM |
100 ug |
Ask for price |
SRGN sgRNA CRISPR Lentivector set (Human) |
K2284901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Human SRGN(Serglycin) ELISA Kit