Human SFN(Stratifin) ELISA Kit

Human SFN(Stratifin) ELISA Kit

Human Stratifin (SFN) ELISA Kit

RDR-SFN-Hu-48Tests 48 Tests
EUR 544

Human Stratifin (SFN) ELISA Kit

RDR-SFN-Hu-96Tests 96 Tests
EUR 756

Human SFN (Stratifin) ELISA KIT

ELI-49767h 96 Tests
EUR 824

Human Stratifin (SFN) ELISA Kit

20-abx153184
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Stratifin (SFN)ELISA Kit

201-12-2409 96 tests
EUR 440
  • This Stratifin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Stratifin ELISA Kit (SFN)

RK02272 96 Tests
EUR 521

Human Stratifin(SFN)ELISA Kit

QY-E03598 96T
EUR 361

Human Stratifin (SFN) ELISA Kit

SEH179Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stratifin (SFN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stratifin (SFN) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Stratifin (SFN) ELISA Kit

SEH179Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stratifin (SFN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stratifin (SFN) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Stratifin (SFN) ELISA Kit

SEH179Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stratifin (SFN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stratifin (SFN) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Stratifin (SFN) ELISA Kit

SEH179Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stratifin (SFN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stratifin (SFN) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Stratifin (SFN) ELISA Kit

4-SEH179Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Stratifin elisa. Alternative names of the recognized antigen: YWHAS
  • HME1
  • 14-3-3 Protein Sigma
  • Epithelial cell marker protein 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Stratifin (SFN) in samples from Serum, plasma, cerebrospinal fluid and other biological fluids with no significant corss-reactivity with analogues from other species.

Bovine SFN (Stratifin) ELISA KIT

ELI-49743b 96 Tests
EUR 928

Mouse SFN (Stratifin) ELISA KIT

ELI-49744m 96 Tests
EUR 865

Rat StRatifin(SFN)ELISA Kit

QY-E10473 96T
EUR 361

Stratifin (SFN) Antibody

20-abx115864
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Stratifin (SFN) Antibody

20-abx100293
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Stratifin (SFN) Antibody

20-abx100294
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Stratifin (SFN) Antibody

20-abx174650
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Stratifin (SFN) Antibody

20-abx325481
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Stratifin (SFN) Antibody

20-abx338920
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Stratifin (SFN)

4-RPH179Hu01
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P31947
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.3kDa
  • Isoelectric Point: 4.9
Description: Recombinant Human Stratifin expressed in: E.coli

Recombinant Stratifin (SFN)

4-RPH179Mu01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O70456
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.5kDa
  • Isoelectric Point: 5.1
Description: Recombinant Mouse Stratifin expressed in: E.coli

ELISA kit for Human SFN (Stratifin)

ELK3118 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stratifin (SFN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stratifin (SFN). N
  • Show more
Description: A sandwich ELISA kit for detection of Stratifin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Stratifin (SFN) CLIA Kit

20-abx495400
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Stratifin (SFN) Protein

20-abx069174
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Stratifin (SFN) Protein

abx060030-100ug 100 ug
EUR 328
  • Shipped within 5-10 working days.

Mouse Stratifin (SFN) Protein

20-abx069176
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Stratifin (SFN) Antibody (FITC)

20-abx273571
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Stratifin (SFN) Antibody (HRP)

20-abx334440
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Stratifin (SFN) Antibody (FITC)

20-abx334441
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Stratifin (SFN) Antibody (Biotin)

20-abx334442
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Stratifin (SFN) Antibody (Biotin)

20-abx272403
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Stratifin (SFN) Polyclonal Antibody (Mouse)

4-PAH179Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN)

Stratifin (SFN) Polyclonal Antibody (Human, Rat)

4-PAH179Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser248)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN)

Stratifin (SFN) Polyclonal Antibody (Human, Rat), APC

4-PAH179Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser248)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with APC.

Stratifin (SFN) Polyclonal Antibody (Human, Rat), Biotinylated

4-PAH179Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser248)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with Biotin.

Stratifin (SFN) Polyclonal Antibody (Human, Rat), Cy3

4-PAH179Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser248)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with Cy3.

Stratifin (SFN) Polyclonal Antibody (Human, Rat), FITC

4-PAH179Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser248)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with FITC.

Stratifin (SFN) Polyclonal Antibody (Human, Rat), HRP

4-PAH179Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser248)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with HRP.

Stratifin (SFN) Polyclonal Antibody (Human, Rat), PE

4-PAH179Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser248)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with PE.

Stratifin (SFN) Polyclonal Antibody (Mouse), APC

4-PAH179Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with APC.

Stratifin (SFN) Polyclonal Antibody (Mouse), Biotinylated

4-PAH179Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with Biotin.

Stratifin (SFN) Polyclonal Antibody (Mouse), Cy3

4-PAH179Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with Cy3.

Stratifin (SFN) Polyclonal Antibody (Mouse), FITC

4-PAH179Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with FITC.

Stratifin (SFN) Polyclonal Antibody (Mouse), HRP

4-PAH179Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with HRP.

Stratifin (SFN) Polyclonal Antibody (Mouse), PE

4-PAH179Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with PE.

Stratifin (SFN) Polyclonal Antibody (Human, Rat), APC-Cy7

4-PAH179Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser248)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with APC-Cy7.

Stratifin (SFN) Polyclonal Antibody (Mouse), APC-Cy7

4-PAH179Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with APC-Cy7.

Polyclonal SFN / Stratifin / 14-3-3 Sigma Antibody (Internal)

APR13298G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SFN / Stratifin / 14-3-3 Sigma (Internal). This antibody is tested and proven to work in the following applications:

Human SFN ELISA Kit

ELA-E15106h 96 Tests
EUR 824

SFN ELISA KIT|Human

EF005907 96 Tests
EUR 689

Polyclonal SFN / Stratifin / 14-3-3 Sigma Antibody (aa120-170)

APR13296G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SFN / Stratifin / 14-3-3 Sigma (aa120-170). This antibody is tested and proven to work in the following applications:

Polyclonal SFN / Stratifin / 14-3-3 Sigma Antibody (N-Terminus)

APR13299G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SFN / Stratifin / 14-3-3 Sigma (N-Terminus). This antibody is tested and proven to work in the following applications:

Monoclonal SFN / Stratifin / 14-3-3 Sigma Antibody (clone 3C3), Clone: 3C3

APR13297G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human SFN / Stratifin / 14-3-3 Sigma (clone 3C3). The antibodies are raised in Mouse and are from clone 3C3. This antibody is applicable in WB and IHC-P

SFN

E541-319 100ug
EUR 343

Mouse StMouseifin(SFN)ELISA Kit

QY-E21402 96T
EUR 361

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Stratifin Antibody (Biotin)

abx430936-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

SFN antibody

70R-5570 50 ug
EUR 467
Description: Rabbit polyclonal SFN antibody raised against the middle region of SFN

SFN antibody

70R-9288 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SFN antibody

SFN Antibody

ABD6189 100 ug
EUR 438

SFN Antibody

43001-100ul 100ul
EUR 252

SFN Antibody

32126-100ul 100ul
EUR 252

SFN antibody

70R-20201 50 ul
EUR 435
Description: Rabbit polyclonal SFN antibody

SFN antibody

70R-14334 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal SFN antibody

SFN Antibody

DF6189 200ul
EUR 304
Description: SFN Antibody detects endogenous levels of total SFN.

SFN siRNA

20-abx933104
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SFN siRNA

20-abx933105
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SFN Antibody

1-CSB-PA008892
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SFN. Recognizes SFN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

SFN Antibody

1-CSB-PA021135GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SFN. Recognizes SFN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA

SFN Antibody

1-CSB-PA021135LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SFN. Recognizes SFN from Human, Rat, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000, IF:1:200-1:500

SFN antibody

PAab09897 100 ug
EUR 386

pOTB7-SFN

PVT18303 2 ug
EUR 231

Human SFN shRNA Plasmid

20-abx951877
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SFN Recombinant Protein (Human)

RP028300 100 ug Ask for price

SFN Recombinant Protein (Human)

RP028303 100 ug Ask for price

Human 14-3-3 protein sigma(SFN) ELISA kit

E01P0214-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 14-3-3 protein sigma(SFN) ELISA kit

E01P0214-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 14-3-3 protein sigma(SFN) ELISA kit

E01P0214-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human SFN/ 14-3-3 protein sigma ELISA Kit

E2271Hu 1 Kit
EUR 605

Human SFN(14-3-3 protein sigma) ELISA Kit

EH1771 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: P31947
  • Alias: SFN/14-3-3 protein sigma/Epithelial cell marker protein 1/Stratifin/HME1/YWHAS
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human 14-3-3 protein sigma (SFN) ELISA Kit

abx251077-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human 14-3-3 protein sigma(SFN) ELISA kit

CSB-EL021135HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human 14-3-3 protein sigma (SFN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human 14-3-3 protein sigma(SFN) ELISA kit

1-CSB-EL021135HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human 14-3-3 protein sigma(SFN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

SFN Conjugated Antibody

C32126 100ul
EUR 397

SFN cloning plasmid

CSB-CL021135HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 747
  • Sequence: atggagagagccagtctgatccagaaggccaagctggcagagcaggccgaacgctatgaggacatggcagccttcatgaaaggcgccgtggagaagggcgaggagctctcctgcgaagagcgaaacctgctctcagtagcctataagaacgtggtgggcggccagagggctgcctg
  • Show more
Description: A cloning plasmid for the SFN gene.

SFN cloning plasmid

CSB-CL021135HU2-10ug 10ug
EUR 292
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 651
  • Sequence: atggagagagccagtctgatccagaaggccaagctggcagagcaggccgaacgctatgaggacatggcagccttcatgaaaggcgccgtggagaagggcgaggagctctcctgcgaagagcgaaacctgctctcagtagcctataagaacgtggtgggcggccagagggctgcctg
  • Show more
Description: A cloning plasmid for the SFN gene.

anti- SFN antibody

FNab09897 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • Immunogen: 14-3-3 protein sigma
  • Uniprot ID: P31947
  • Gene ID: 2810
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against SFN

SFN Polyclonal Antibody

A-2745 100 µl
EUR 483.55
Description: kits suitable for this type of research

SFN Rabbit pAb

A1026-100ul 100 ul
EUR 308

SFN Rabbit pAb

A1026-200ul 200 ul
EUR 459

SFN Rabbit pAb

A1026-20ul 20 ul
EUR 183

SFN Rabbit pAb

A1026-50ul 50 ul
EUR 223

SFN Blocking Peptide

33R-2923 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SFN antibody, catalog no. 70R-5570

SFN Blocking Peptide

33R-9879 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SFN antibody, catalog no. 70R-9288

SFN Blocking Peptide

DF6189-BP 1mg
EUR 195

anti- SFN antibody

LSMab09897 100 ug
EUR 386

pCMV-SPORT6-SFN

PVT13720 2 ug
EUR 391

Anti-SFN Antibody

STJ502960 100 µg
EUR 476

Anti-SFN antibody

STJ25500 100 µl
EUR 277

Anti-SFN antibody

STJ119984 100 µl
EUR 413

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

SFN ORF Vector (Human) (pORF)

ORF009434 1.0 ug DNA
EUR 95

SFN ORF Vector (Human) (pORF)

ORF009435 1.0 ug DNA
EUR 95

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

ELISA kit for Human 14-3-3 protein sigma (SFN)

KTE60683-48T 48T
EUR 332
  • Stratifin, was shown to be diffusely distributed in the cytoplasm and was present in cultured epithelial cells. It was most abundant in tissues enriched in stratified keratinizing epithelium.The induction of 14-3-3-sigma is mediated by a p53 -respons
  • Show more
Description: Quantitative sandwich ELISA for measuring Human 14-3-3 protein sigma (SFN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human 14-3-3 protein sigma (SFN)

KTE60683-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Stratifin, was shown to be diffusely distributed in the cytoplasm and was present in cultured epithelial cells. It was most abundant in tissues enriched in stratified keratinizing epithelium.The induction of 14-3-3-sigma is mediated by a p53 -respons
  • Show more
Description: Quantitative sandwich ELISA for measuring Human 14-3-3 protein sigma (SFN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human 14-3-3 protein sigma (SFN)

KTE60683-96T 96T
EUR 539
  • Stratifin, was shown to be diffusely distributed in the cytoplasm and was present in cultured epithelial cells. It was most abundant in tissues enriched in stratified keratinizing epithelium.The induction of 14-3-3-sigma is mediated by a p53 -respons
  • Show more
Description: Quantitative sandwich ELISA for measuring Human 14-3-3 protein sigma (SFN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Polyclonal SFN Antibody (Center)

APR17857G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SFN (Center). This antibody is tested and proven to work in the following applications:

Polyclonal SFN Antibody (Center)

APR13281G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SFN (Center). This antibody is tested and proven to work in the following applications:

Mouse SFN shRNA Plasmid

20-abx974565
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SFN Antibody, HRP conjugated

1-CSB-PA021135LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SFN. Recognizes SFN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SFN Antibody, FITC conjugated

1-CSB-PA021135LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SFN. Recognizes SFN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SFN Antibody, Biotin conjugated

1-CSB-PA021135LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SFN. Recognizes SFN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SFN Recombinant Protein (Mouse)

RP171359 100 ug Ask for price

Anti-SFN Antibody (Biotin)

STJ502961 100 µg
EUR 586

Anti-SFN Antibody (FITC)

STJ502962 100 µg
EUR 586

SFN sgRNA CRISPR Lentivector set (Human)

K2131401 3 x 1.0 ug
EUR 339

Mouse 14-3-3 protein sigma (SFN) ELISA Kit

abx556082-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat 14-3-3 protein sigma(SFN) ELISA kit

E02P0214-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 14-3-3 protein sigma(SFN) ELISA kit

E02P0214-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 14-3-3 protein sigma(SFN) ELISA kit

E02P0214-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 14-3-3 protein sigma(SFN) ELISA kit

E03P0214-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 14-3-3 protein sigma(SFN) ELISA kit

E03P0214-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 14-3-3 protein sigma(SFN) ELISA kit

E03P0214-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 14-3-3 protein sigma(SFN) ELISA kit

E04P0214-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 14-3-3 protein sigma(SFN) ELISA kit

E04P0214-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 14-3-3 protein sigma(SFN) ELISA kit

E04P0214-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 14-3-3 protein sigma(SFN) ELISA kit

E06P0214-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 14-3-3 protein sigma(SFN) ELISA kit

E06P0214-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 14-3-3 protein sigma(SFN) ELISA kit

E06P0214-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 14-3-3 protein sigma(SFN) ELISA kit

E07P0214-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 14-3-3 protein sigma(SFN) ELISA kit

E07P0214-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 14-3-3 protein sigma(SFN) ELISA kit

E07P0214-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 14-3-3 protein sigma(SFN) ELISA kit

E08P0214-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 14-3-3 protein sigma(SFN) ELISA kit

E08P0214-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 14-3-3 protein sigma(SFN) ELISA kit

E08P0214-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Sfn/ 14-3-3 protein sigma ELISA Kit

E1336Mo 1 Kit
EUR 632

Monkey 14-3-3 protein sigma(SFN) ELISA kit

E09P0214-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey 14-3-3 protein sigma(SFN) ELISA kit

E09P0214-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey 14-3-3 protein sigma(SFN) ELISA kit

E09P0214-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Guinea pig 14-3-3 protein sigma(SFN) ELISA kit

E05P0214-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig 14-3-3 protein sigma(SFN) ELISA kit

E05P0214-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig 14-3-3 protein sigma(SFN) ELISA kit

E05P0214-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

SFN sgRNA CRISPR Lentivector (Human) (Target 1)

K2131402 1.0 ug DNA
EUR 154

SFN sgRNA CRISPR Lentivector (Human) (Target 2)

K2131403 1.0 ug DNA
EUR 154

SFN sgRNA CRISPR Lentivector (Human) (Target 3)

K2131404 1.0 ug DNA
EUR 154

Human 14-3-3 protein sigma (SFN)

1-CSB-EP021135HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 54.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 14-3-3 protein sigma(SFN) expressed in E.coli

SFN Protein Vector (Human) (pPB-C-His)

PV037733 500 ng
EUR 329

SFN Protein Vector (Human) (pPB-N-His)

PV037734 500 ng
EUR 329

SFN Protein Vector (Human) (pPM-C-HA)

PV037735 500 ng
EUR 329

SFN Protein Vector (Human) (pPM-C-His)

PV037736 500 ng
EUR 329

SFN Protein Vector (Human) (pPB-C-His)

PV037737 500 ng
EUR 329

SFN Protein Vector (Human) (pPB-N-His)

PV037738 500 ng
EUR 329

SFN Protein Vector (Human) (pPM-C-HA)

PV037739 500 ng
EUR 329

SFN Protein Vector (Human) (pPM-C-His)

PV037740 500 ng
EUR 329

Polyclonal SFN Antibody (C-term)

APR17856G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SFN (C-term). This antibody is tested and proven to work in the following applications:

Human SFN(Stratifin) ELISA Kit