Human SFN(Stratifin) ELISA Kit

Human SFN(Stratifin) ELISA Kit

Human Stratifin (SFN) ELISA Kit
RDR-SFN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Stratifin (SFN) ELISA Kit
RDR-SFN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human SFN (Stratifin) ELISA KIT
ELI-49767h	Lifescience Market	96 Tests	EUR 824

Human Stratifin (SFN) ELISA Kit
20-abx153184	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Stratifin (SFN)ELISA Kit
201-12-2409	SunredBio	96 tests	EUR 440
This Stratifin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Stratifin ELISA Kit (SFN)
RK02272	Abclonal	96 Tests	EUR 521

Human Stratifin(SFN)ELISA Kit
QY-E03598	Qayee Biotechnology	96T	EUR 361

Human Stratifin (SFN) ELISA Kit
SEH179Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stratifin (SFN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stratifin (SFN) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Stratifin (SFN) ELISA Kit
SEH179Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stratifin (SFN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stratifin (SFN) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Stratifin (SFN) ELISA Kit
SEH179Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stratifin (SFN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stratifin (SFN) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Stratifin (SFN) ELISA Kit
SEH179Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stratifin (SFN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stratifin (SFN) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Stratifin (SFN) ELISA Kit
4-SEH179Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Stratifin elisa. Alternative names of the recognized antigen: YWHAS HME1 14-3-3 Protein Sigma Epithelial cell marker protein 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Stratifin (SFN) in samples from Serum, plasma, cerebrospinal fluid and other biological fluids with no significant corss-reactivity with analogues from other species.

Bovine SFN (Stratifin) ELISA KIT
ELI-49743b	Lifescience Market	96 Tests	EUR 928

Mouse SFN (Stratifin) ELISA KIT
ELI-49744m	Lifescience Market	96 Tests	EUR 865

Rat StRatifin(SFN)ELISA Kit
QY-E10473	Qayee Biotechnology	96T	EUR 361

Stratifin (SFN) Antibody
20-abx115864	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Stratifin (SFN) Antibody
20-abx100293	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Stratifin (SFN) Antibody
20-abx100294	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Stratifin (SFN) Antibody
20-abx174650	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Stratifin (SFN) Antibody
20-abx325481	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Stratifin (SFN) Antibody
20-abx338920	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Recombinant Stratifin (SFN)
4-RPH179Hu01	Cloud-Clone	EUR 368.80 EUR 202.00 EUR 1108.00 EUR 436.00 EUR 772.00 EUR 310.00 EUR 2620.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P31947 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.3kDa Isoelectric Point: 4.9
Description: Recombinant Human Stratifin expressed in: E.coli

Recombinant Stratifin (SFN)
4-RPH179Mu01	Cloud-Clone	EUR 440.48 EUR 221.00 EUR 1376.80 EUR 525.60 EUR 951.20 EUR 358.00 EUR 3292.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O70456 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 31.5kDa Isoelectric Point: 5.1
Description: Recombinant Mouse Stratifin expressed in: E.coli

ELISA kit for Human SFN (Stratifin)
ELK3118	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stratifin (SFN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stratifin (SFN). N Show more
Description: A sandwich ELISA kit for detection of Stratifin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Stratifin (SFN) CLIA Kit
20-abx495400	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Stratifin (SFN) Protein
20-abx069174	Abbexa	EUR 523.00 EUR 244.00 EUR 1497.00 EUR 606.00 EUR 384.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Human Stratifin (SFN) Protein
abx060030-100ug	Abbexa	100 ug	EUR 328
Shipped within 5-10 working days.

Mouse Stratifin (SFN) Protein
20-abx069176	Abbexa	EUR 620.00 EUR 272.00 EUR 1859.00 EUR 732.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Stratifin (SFN) Antibody (FITC)
20-abx273571	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Stratifin (SFN) Antibody (HRP)
20-abx334440	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Stratifin (SFN) Antibody (FITC)
20-abx334441	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Stratifin (SFN) Antibody (Biotin)
20-abx334442	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Stratifin (SFN) Antibody (Biotin)
20-abx272403	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Stratifin (SFN) Polyclonal Antibody (Mouse)
4-PAH179Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SFN (Met1~Ser249) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN)

Stratifin (SFN) Polyclonal Antibody (Human, Rat)
4-PAH179Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SFN (Met1~Ser248) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN)

Stratifin (SFN) Polyclonal Antibody (Human, Rat), APC
4-PAH179Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SFN (Met1~Ser248) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with APC.

Stratifin (SFN) Polyclonal Antibody (Human, Rat), Biotinylated
4-PAH179Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SFN (Met1~Ser248) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with Biotin.

Stratifin (SFN) Polyclonal Antibody (Human, Rat), Cy3
4-PAH179Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SFN (Met1~Ser248) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with Cy3.

Stratifin (SFN) Polyclonal Antibody (Human, Rat), FITC
4-PAH179Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SFN (Met1~Ser248) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with FITC.

Stratifin (SFN) Polyclonal Antibody (Human, Rat), HRP
4-PAH179Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SFN (Met1~Ser248) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with HRP.

Stratifin (SFN) Polyclonal Antibody (Human, Rat), PE
4-PAH179Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SFN (Met1~Ser248) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with PE.

Stratifin (SFN) Polyclonal Antibody (Mouse), APC
4-PAH179Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SFN (Met1~Ser249) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with APC.

Stratifin (SFN) Polyclonal Antibody (Mouse), Biotinylated
4-PAH179Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SFN (Met1~Ser249) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with Biotin.

Stratifin (SFN) Polyclonal Antibody (Mouse), Cy3
4-PAH179Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SFN (Met1~Ser249) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with Cy3.

Stratifin (SFN) Polyclonal Antibody (Mouse), FITC
4-PAH179Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SFN (Met1~Ser249) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with FITC.

Stratifin (SFN) Polyclonal Antibody (Mouse), HRP
4-PAH179Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SFN (Met1~Ser249) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with HRP.

Stratifin (SFN) Polyclonal Antibody (Mouse), PE
4-PAH179Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SFN (Met1~Ser249) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with PE.

Stratifin (SFN) Polyclonal Antibody (Human, Rat), APC-Cy7
4-PAH179Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SFN (Met1~Ser248) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with APC-Cy7.

Stratifin (SFN) Polyclonal Antibody (Mouse), APC-Cy7
4-PAH179Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SFN (Met1~Ser249) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with APC-Cy7.

Polyclonal SFN / Stratifin / 14-3-3 Sigma Antibody (Internal)
APR13298G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SFN / Stratifin / 14-3-3 Sigma (Internal). This antibody is tested and proven to work in the following applications:

Human SFN ELISA Kit
ELA-E15106h	Lifescience Market	96 Tests	EUR 824

SFN ELISA KIT\|Human
EF005907	Lifescience Market	96 Tests	EUR 689

Polyclonal SFN / Stratifin / 14-3-3 Sigma Antibody (aa120-170)
APR13296G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SFN / Stratifin / 14-3-3 Sigma (aa120-170). This antibody is tested and proven to work in the following applications:

Polyclonal SFN / Stratifin / 14-3-3 Sigma Antibody (N-Terminus)
APR13299G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SFN / Stratifin / 14-3-3 Sigma (N-Terminus). This antibody is tested and proven to work in the following applications:

SFN ELISA Kit (Human) (OKAN06228)
OKAN06228	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a cell cycle checkpoint protein. The encoded protein binds to translation and initiation factors and functions as a regulator of mitotic translation. In response to DNA damage this protein plays a role in preventing DNA errors during mitosis.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 11.9 pg/mL

SFN ELISA Kit (Human) (OKCD09035)
OKCD09035	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: SFN is an adapter protein implicated in the regulation of a large spectrum of both general and specialized signaling pathway. SFN binds to a large number of partners, usually by recognition of a phosphoserine or phosphothreonine motif. Binding generally results in the modulation of the activity of the binding partner. When bound to KRT17, SFN regulates protein synthesis and epithelial cell growth by stimulating Akt/mTOR pathway.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 11.9pg/mL

SFN ELISA Kit (Human) (OKEH02507)
OKEH02507	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 18 pg/mL

Monoclonal SFN / Stratifin / 14-3-3 Sigma Antibody (clone 3C3), Clone: 3C3
APR13297G	Leading Biology	0.05mg	EUR 528
Description: A Monoclonal antibody against Human SFN / Stratifin / 14-3-3 Sigma (clone 3C3). The antibodies are raised in Mouse and are from clone 3C3. This antibody is applicable in WB and IHC-P

SFN
E541-319	EnoGene	100ug	EUR 343

Mouse StMouseifin(SFN)ELISA Kit
QY-E21402	Qayee Biotechnology	96T	EUR 361

SFN ELISA Kit (Bovine) (OKEH08146)
OKEH08146	Aviva Systems Biology	96 Wells	EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Stratifin Antibody (Biotin)
abx430936-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

SFN antibody
70R-5570	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal SFN antibody raised against the middle region of SFN

SFN antibody
70R-9288	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal SFN antibody

SFN Antibody
ABD6189	Lifescience Market	100 ug	EUR 438

SFN Antibody
43001-100ul	SAB	100ul	EUR 252

SFN Antibody
32126-100ul	SAB	100ul	EUR 252

SFN antibody
70R-20201	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal SFN antibody

SFN antibody
70R-14334	Fitzgerald	100 ug	EUR 322
Description: Affinity purified Rabbit polyclonal SFN antibody

SFN Antibody
DF6189	Affbiotech	200ul	EUR 304
Description: SFN Antibody detects endogenous levels of total SFN.

SFN siRNA
20-abx933104	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SFN siRNA
20-abx933105	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SFN Antibody
1-CSB-PA008892	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SFN. Recognizes SFN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

SFN Antibody
1-CSB-PA021135GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SFN. Recognizes SFN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA

SFN Antibody
1-CSB-PA021135LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SFN. Recognizes SFN from Human, Rat, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000, IF:1:200-1:500

SFN antibody
PAab09897	Lifescience Market	100 ug	EUR 386

pOTB7-SFN
PVT18303	Lifescience Market	2 ug	EUR 231

Human SFN shRNA Plasmid
20-abx951877	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SFN Recombinant Protein (Human)
RP028300	ABM	100 ug	Ask for price

SFN Recombinant Protein (Human)
RP028303	ABM	100 ug	Ask for price

Human 14-3-3 protein sigma(SFN) ELISA kit
E01P0214-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 14-3-3 protein sigma(SFN) ELISA kit
E01P0214-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 14-3-3 protein sigma(SFN) ELISA kit
E01P0214-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human SFN/ 14-3-3 protein sigma ELISA Kit
E2271Hu	Sunlong	1 Kit	EUR 605

Human SFN(14-3-3 protein sigma) ELISA Kit
EH1771	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml Uniprot ID: P31947 Alias: SFN/14-3-3 protein sigma/Epithelial cell marker protein 1/Stratifin/HME1/YWHAS
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human 14-3-3 protein sigma (SFN) ELISA Kit
abx251077-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Human 14-3-3 protein sigma(SFN) ELISA kit
CSB-EL021135HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human 14-3-3 protein sigma (SFN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human 14-3-3 protein sigma(SFN) ELISA kit
1-CSB-EL021135HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human 14-3-3 protein sigma(SFN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

SFN Conjugated Antibody
C32126	SAB	100ul	EUR 397

SFN cloning plasmid
CSB-CL021135HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 747 Sequence: atggagagagccagtctgatccagaaggccaagctggcagagcaggccgaacgctatgaggacatggcagccttcatgaaaggcgccgtggagaagggcgaggagctctcctgcgaagagcgaaacctgctctcagtagcctataagaacgtggtgggcggccagagggctgcctg Show more
Description: A cloning plasmid for the SFN gene.

SFN cloning plasmid
CSB-CL021135HU2-10ug	Cusabio	10ug	EUR 292
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 651 Sequence: atggagagagccagtctgatccagaaggccaagctggcagagcaggccgaacgctatgaggacatggcagccttcatgaaaggcgccgtggagaagggcgaggagctctcctgcgaagagcgaaacctgctctcagtagcctataagaacgtggtgggcggccagagggctgcctg Show more
Description: A cloning plasmid for the SFN gene.

anti- SFN antibody
FNab09897	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:100 Immunogen: 14-3-3 protein sigma Uniprot ID: P31947 Gene ID: 2810 Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against SFN

SFN Polyclonal Antibody
A-2745	EpiGentek	100 µl	EUR 483.55
Description: kits suitable for this type of research

SFN Rabbit pAb
A1026-100ul	Abclonal	100 ul	EUR 308

SFN Rabbit pAb
A1026-200ul	Abclonal	200 ul	EUR 459

SFN Rabbit pAb
A1026-20ul	Abclonal	20 ul	EUR 183

SFN Rabbit pAb
A1026-50ul	Abclonal	50 ul	EUR 223

SFN Blocking Peptide
33R-2923	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SFN antibody, catalog no. 70R-5570

SFN Blocking Peptide
33R-9879	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SFN antibody, catalog no. 70R-9288

SFN Blocking Peptide
DF6189-BP	Affbiotech	1mg	EUR 195

anti- SFN antibody
LSMab09897	Lifescience Market	100 ug	EUR 386

pCMV-SPORT6-SFN
PVT13720	Lifescience Market	2 ug	EUR 391

Anti-SFN Antibody
STJ502960	St John's Laboratory	100 µg	EUR 476

Anti-SFN antibody
STJ25500	St John's Laboratory	100 µl	EUR 277

Anti-SFN antibody
STJ119984	St John's Laboratory	100 µl	EUR 413

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

SFN ORF Vector (Human) (pORF)
ORF009434	ABM	1.0 ug DNA	EUR 95

SFN ORF Vector (Human) (pORF)
ORF009435	ABM	1.0 ug DNA	EUR 95

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

ELISA kit for Human 14-3-3 protein sigma (SFN)
KTE60683-48T	Abbkine	48T	EUR 332
Stratifin, was shown to be diffusely distributed in the cytoplasm and was present in cultured epithelial cells. It was most abundant in tissues enriched in stratified keratinizing epithelium.The induction of 14-3-3-sigma is mediated by a p53 -respons Show more
Description: Quantitative sandwich ELISA for measuring Human 14-3-3 protein sigma (SFN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human 14-3-3 protein sigma (SFN)
KTE60683-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Stratifin, was shown to be diffusely distributed in the cytoplasm and was present in cultured epithelial cells. It was most abundant in tissues enriched in stratified keratinizing epithelium.The induction of 14-3-3-sigma is mediated by a p53 -respons Show more
Description: Quantitative sandwich ELISA for measuring Human 14-3-3 protein sigma (SFN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human 14-3-3 protein sigma (SFN)
KTE60683-96T	Abbkine	96T	EUR 539
Stratifin, was shown to be diffusely distributed in the cytoplasm and was present in cultured epithelial cells. It was most abundant in tissues enriched in stratified keratinizing epithelium.The induction of 14-3-3-sigma is mediated by a p53 -respons Show more
Description: Quantitative sandwich ELISA for measuring Human 14-3-3 protein sigma (SFN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Polyclonal SFN Antibody (Center)
APR17857G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SFN (Center). This antibody is tested and proven to work in the following applications:

Polyclonal SFN Antibody (Center)
APR13281G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SFN (Center). This antibody is tested and proven to work in the following applications:

Mouse SFN shRNA Plasmid
20-abx974565	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SFN Antibody, HRP conjugated
1-CSB-PA021135LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SFN. Recognizes SFN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SFN Antibody, FITC conjugated
1-CSB-PA021135LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SFN. Recognizes SFN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SFN Antibody, Biotin conjugated
1-CSB-PA021135LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SFN. Recognizes SFN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SFN Recombinant Protein (Mouse)
RP171359	ABM	100 ug	Ask for price

Anti-SFN Antibody (Biotin)
STJ502961	St John's Laboratory	100 µg	EUR 586

Anti-SFN Antibody (FITC)
STJ502962	St John's Laboratory	100 µg	EUR 586

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

SFN sgRNA CRISPR Lentivector set (Human)
K2131401	ABM	3 x 1.0 ug	EUR 339

Mouse 14-3-3 protein sigma (SFN) ELISA Kit
abx556082-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat 14-3-3 protein sigma(SFN) ELISA kit
E02P0214-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 14-3-3 protein sigma(SFN) ELISA kit
E02P0214-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 14-3-3 protein sigma(SFN) ELISA kit
E02P0214-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 14-3-3 protein sigma(SFN) ELISA kit
E03P0214-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 14-3-3 protein sigma(SFN) ELISA kit
E03P0214-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 14-3-3 protein sigma(SFN) ELISA kit
E03P0214-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 14-3-3 protein sigma(SFN) ELISA kit
E04P0214-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 14-3-3 protein sigma(SFN) ELISA kit
E04P0214-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 14-3-3 protein sigma(SFN) ELISA kit
E04P0214-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 14-3-3 protein sigma(SFN) ELISA kit
E06P0214-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 14-3-3 protein sigma(SFN) ELISA kit
E06P0214-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 14-3-3 protein sigma(SFN) ELISA kit
E06P0214-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 14-3-3 protein sigma(SFN) ELISA kit
E07P0214-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 14-3-3 protein sigma(SFN) ELISA kit
E07P0214-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 14-3-3 protein sigma(SFN) ELISA kit
E07P0214-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 14-3-3 protein sigma(SFN) ELISA kit
E08P0214-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 14-3-3 protein sigma(SFN) ELISA kit
E08P0214-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 14-3-3 protein sigma(SFN) ELISA kit
E08P0214-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Sfn/ 14-3-3 protein sigma ELISA Kit
E1336Mo	Sunlong	1 Kit	EUR 632

Monkey 14-3-3 protein sigma(SFN) ELISA kit
E09P0214-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey 14-3-3 protein sigma(SFN) ELISA kit
E09P0214-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey 14-3-3 protein sigma(SFN) ELISA kit
E09P0214-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Guinea pig 14-3-3 protein sigma(SFN) ELISA kit
E05P0214-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig 14-3-3 protein sigma(SFN) ELISA kit
E05P0214-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig 14-3-3 protein sigma(SFN) ELISA kit
E05P0214-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

SFN sgRNA CRISPR Lentivector (Human) (Target 1)
K2131402	ABM	1.0 ug DNA	EUR 154

SFN sgRNA CRISPR Lentivector (Human) (Target 2)
K2131403	ABM	1.0 ug DNA	EUR 154

SFN sgRNA CRISPR Lentivector (Human) (Target 3)
K2131404	ABM	1.0 ug DNA	EUR 154

Human 14-3-3 protein sigma (SFN)
1-CSB-EP021135HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 54.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 14-3-3 protein sigma(SFN) expressed in E.coli

SFN Protein Vector (Human) (pPB-C-His)
PV037733	ABM	500 ng	EUR 329

SFN Protein Vector (Human) (pPB-N-His)
PV037734	ABM	500 ng	EUR 329

SFN Protein Vector (Human) (pPM-C-HA)
PV037735	ABM	500 ng	EUR 329

SFN Protein Vector (Human) (pPM-C-His)
PV037736	ABM	500 ng	EUR 329

SFN Protein Vector (Human) (pPB-C-His)
PV037737	ABM	500 ng	EUR 329

Human SFN(Stratifin) ELISA Kit