Human OLFM4(Olfactomedin 4) ELISA Kit

Human OLFM4(Olfactomedin 4) ELISA Kit

Human Olfactomedin 4 (OLFM4) ELISA Kit

RD-OLFM4-Hu-96Tests 96 Tests
EUR 662

Mouse Olfactomedin 4 (OLFM4) ELISA Kit

DLR-OLFM4-Mu-48T 48T
EUR 489
  • Should the Mouse Olfactomedin 4 (OLFM4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Olfactomedin 4 (OLFM4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Olfactomedin 4 (OLFM4) ELISA Kit

DLR-OLFM4-Mu-96T 96T
EUR 635
  • Should the Mouse Olfactomedin 4 (OLFM4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Olfactomedin 4 (OLFM4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Olfactomedin 4 (OLFM4) ELISA Kit

RDR-OLFM4-Mu-48Tests 48 Tests
EUR 511

Mouse Olfactomedin 4 (OLFM4) ELISA Kit

RDR-OLFM4-Mu-96Tests 96 Tests
EUR 709

Mouse Olfactomedin 4 (OLFM4) ELISA Kit

RD-OLFM4-Mu-48Tests 48 Tests
EUR 489

Mouse Olfactomedin 4 (OLFM4) ELISA Kit

RD-OLFM4-Mu-96Tests 96 Tests
EUR 677

Human Olfactomedin 4 (OLFM4) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Olfactomedin 4 (OLFM4) ELISA Kit

abx252865-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human OLFM4(Olfactomedin 4) ELISA Kit

EH3477 96T
EUR 524.1
  • Detection range: 62.5-4000 pg/ml
  • Uniprot ID: Q6UX06
  • Alias: OLFM4
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 37.5pg/ml

Human Olfactomedin- 4, OLFM4 ELISA KIT

ELI-44595h 96 Tests
EUR 824

Human Olfactomedin 4 (OLFM4) ELISA Kit

SEA162Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Olfactomedin 4 (OLFM4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Olfactomedin 4 (OLFM4) in serum, plasma, tissue homogenates and other biological fluids.

Human Olfactomedin 4 (OLFM4) ELISA Kit

SEA162Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Olfactomedin 4 (OLFM4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Olfactomedin 4 (OLFM4) in serum, plasma, tissue homogenates and other biological fluids.

Human Olfactomedin 4 (OLFM4) ELISA Kit

SEA162Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Olfactomedin 4 (OLFM4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Olfactomedin 4 (OLFM4) in serum, plasma, tissue homogenates and other biological fluids.

Human Olfactomedin 4 (OLFM4) ELISA Kit

SEA162Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Olfactomedin 4 (OLFM4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Olfactomedin 4 (OLFM4) in serum, plasma, tissue homogenates and other biological fluids.

Human Olfactomedin 4 (OLFM4) ELISA Kit

  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Olfactomedin 4 elisa. Alternative names of the recognized antigen: OLM4
  • hGC1
  • hOLfD
  • OlfD
  • GW112
  • GC1
  • G-CSF-stimulated clone 1 protein
  • Antiapoptotic protein GW112
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Olfactomedin 4 (OLFM4) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Olfactomedin 4 (OLFM4) Antibody

  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Olfactomedin 4 (OLFM4) Antibody

  • EUR 1288.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Olfactomedin 4 (OLFM4) Antibody

  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Olfactomedin 4 (OLFM4) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Olfactomedin 4 (OLFM4) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Olfactomedin 4 (OLFM4) Antibody

abx146019-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Olfactomedin 4 (OLFM4) Antibody

  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Olfactomedin 4 (OLFM4) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Olfactomedin 4 (OLFM4) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Olfactomedin 4 (OLFM4) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Olfactomedin 4 (OLFM4)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q6UX06
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 13.8kDa
  • Isoelectric Point: 7.1
Description: Recombinant Human Olfactomedin 4 expressed in: E.coli

Recombinant Olfactomedin 4 (OLFM4)

  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q3UZZ4
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 35.8kDa
  • Isoelectric Point: 5.9
Description: Recombinant Mouse Olfactomedin 4 expressed in: E.coli

Recombinant Olfactomedin 4 (OLFM4)

  • EUR 496.03
  • EUR 236.00
  • EUR 1585.12
  • EUR 595.04
  • EUR 1090.08
  • EUR 395.00
  • EUR 3812.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D3ZMI6
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 13.9kDa
  • Isoelectric Point: 7.9
Description: Recombinant Rat Olfactomedin 4 expressed in: E.coli

Mouse Olfactomedin 4 (OLFM4) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Olfactomedin 4 (OLFM4) ELISA Kit

abx254310-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Mouse Olfactomedin- 4, Olfm4 ELISA KIT

ELI-21819m 96 Tests
EUR 865

Monkey Olfactomedin 4 (OLFM4) ELISA Kit

abx360191-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Olfactomedin 4 (OLFM4) ELISA Kit

abx361951-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Olfactomedin 4 (OLFM4) ELISA Kit

abx363159-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Olfactomedin 4 (OLFM4) ELISA Kit

abx356813-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse OLFM4(Olfactomedin 4) ELISA Kit

EM1252 96T
EUR 524.1
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: Q3UZZ4
  • Alias: OLFM4
Description: Method of detection: Double Antibody, Sandwich ELISA ;Reacts with: Mus ;Sensitivity: 18.75pg/ml

Mouse Olfactomedin 4 (OLFM4) ELISA Kit

SEA162Mu-10x96wellstestplate 10x96-wells test plate
EUR 4391.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Olfactomedin 4 (OLFM4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Olfactomedin 4 (OLFM4) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Olfactomedin 4 (OLFM4) ELISA Kit

SEA162Mu-1x48wellstestplate 1x48-wells test plate
EUR 449.27
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Olfactomedin 4 (OLFM4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Olfactomedin 4 (OLFM4) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Olfactomedin 4 (OLFM4) ELISA Kit

SEA162Mu-1x96wellstestplate 1x96-wells test plate
EUR 598.96
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Olfactomedin 4 (OLFM4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Olfactomedin 4 (OLFM4) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Olfactomedin 4 (OLFM4) ELISA Kit

SEA162Mu-5x96wellstestplate 5x96-wells test plate
EUR 2395.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Olfactomedin 4 (OLFM4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Olfactomedin 4 (OLFM4) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Olfactomedin 4 (OLFM4) ELISA Kit

  • EUR 4442.00
  • EUR 2346.00
  • EUR 599.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Olfactomedin 4 elisa. Alternative names of the recognized antigen: OLM4
  • hGC1
  • hOLfD
  • OlfD
  • GW112
  • GC1
  • G-CSF-stimulated clone 1 protein
  • Antiapoptotic protein GW112
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Olfactomedin 4 (OLFM4) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human OLFM4 (Olfactomedin 4)

E-EL-H2153 1 plate of 96 wells
EUR 534
  • Gentaur's OLFM4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human OLFM4. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human OLFM4 (Olfactomedin 4) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human OLFM4 (Olfactomedin 4)

ELK2796 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Olfactomedin 4 (OLFM4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Olfactomedi
  • Show more
Description: A sandwich ELISA kit for detection of Olfactomedin 4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Olfactomedin 4 (OLFM4) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Olfactomedin 4 (OLFM4) CLIA Kit

abx197372-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Olfactomedin 4 (OLFM4) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Mouse OLFM4 (Olfactomedin 4)

E-EL-M0856 1 plate of 96 wells
EUR 534
  • Gentaur's OLFM4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse OLFM4. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse OLFM4 (Olfactomedin 4) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse OLFM4 (Olfactomedin 4)

ELK2846 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Olfactomedin 4 (OLFM4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Olfactomedi
  • Show more
Description: A sandwich ELISA kit for detection of Olfactomedin 4 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Olfactomedin 4 (OLFM4) CLIA Kit

abx197373-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Olfactomedin 4 (OLFM4) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Olfactomedin 4 (OLFM4) Protein

  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Olfactomedin 4 (OLFM4) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2138.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Olfactomedin 4 (OLFM4) Antibody (Biotin)

  • EUR 425.00
  • EUR 230.00
  • EUR 1191.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Olfactomedin 4 (OLFM4) Antibody (Biotin)

  • EUR 425.00
  • EUR 230.00
  • EUR 1219.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Olfactomedin 4 (OLFM4) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Olfactomedin 4 (OLFM4) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Olfactomedin 4 (OLFM4) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cow Olfactomedin 4 (OLFM4) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Olfactomedin 4 (OLFM4) Antibody (Biotin)

  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Olfactomedin 4 (OLFM4) Antibody (FITC)

  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

OLFM4 ELISA Kit| Mouse Olfactomedin 4 ELISA Kit

EF013800 96 Tests
EUR 689

CLIA kit for Human OLFM4 (Olfactomedin 4)

E-CL-H1278 1 plate of 96 wells
EUR 584
  • Gentaur's OLFM4 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human OLFM4 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human OLFM4 (Olfactomedin 4) in samples from Serum, Plasma, Cell supernatant

Olfactomedin 4 (OLFM4) Polyclonal Antibody (Human)

  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OLFM4 (Ile407~Gln510)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Olfactomedin 4 (OLFM4)

Recombinant Human Olfactomedin-4/OLFM4 Protein

RP00950 10 μg
EUR 221

CLIA kit for Mouse OLFM4 (Olfactomedin 4)

E-CL-M0524 1 plate of 96 wells
EUR 584
  • Gentaur's OLFM4 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse OLFM4 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Mouse OLFM4 (Olfactomedin 4) in samples from Serum, Plasma, Cell supernatant

Polyclonal OLFM4 / Olfactomedin 4 Antibody (Internal)

APR02099G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OLFM4 / Olfactomedin 4 (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal OLFM4 / Olfactomedin 4 Antibody (Internal)

APR02170G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OLFM4 / Olfactomedin 4 (Internal). This antibody is tested and proven to work in the following applications:

Olfactomedin 4 (OLFM4) Polyclonal Antibody (Mouse)

  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OLFM4 (Cys238~Thr500)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Olfactomedin 4 (OLFM4)

Olfactomedin 4 (OLFM4) Polyclonal Antibody (Rat)

  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OLFM4 (Ile405~Val511)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Olfactomedin 4 (OLFM4)

Recombinant Human Olfactomedin-4/OLFM4 (C-10His)

CS01-10ug 10ug
EUR 202
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Human Olfactomedin-4/OLFM4 (C-10His)

CS01-1mg 1mg
EUR 2486
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Human Olfactomedin-4/OLFM4 (C-10His)

CS01-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Human Olfactomedin-4/OLFM4 (C-10His)

CS01-50ug 50ug
EUR 496
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Olfactomedin 4 (OLFM4) Polyclonal Antibody (Human), APC

  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OLFM4 (Ile407~Gln510)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Olfactomedin 4 (OLFM4). This antibody is labeled with APC.

Olfactomedin 4 (OLFM4) Polyclonal Antibody (Human), Biotinylated

  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OLFM4 (Ile407~Gln510)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Olfactomedin 4 (OLFM4). This antibody is labeled with Biotin.

Olfactomedin 4 (OLFM4) Polyclonal Antibody (Human), Cy3

  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OLFM4 (Ile407~Gln510)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Olfactomedin 4 (OLFM4). This antibody is labeled with Cy3.

Olfactomedin 4 (OLFM4) Polyclonal Antibody (Human), FITC

  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OLFM4 (Ile407~Gln510)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Olfactomedin 4 (OLFM4). This antibody is labeled with FITC.

Olfactomedin 4 (OLFM4) Polyclonal Antibody (Human), HRP

  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OLFM4 (Ile407~Gln510)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Olfactomedin 4 (OLFM4). This antibody is labeled with HRP.

Olfactomedin 4 (OLFM4) Polyclonal Antibody (Human), PE

  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OLFM4 (Ile407~Gln510)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Olfactomedin 4 (OLFM4). This antibody is labeled with PE.

Polyclonal OLFM4 / Olfactomedin 4 Antibody (aa400-450)

APR02466G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OLFM4 / Olfactomedin 4 (aa400-450). This antibody is tested and proven to work in the following applications:

Olfactomedin 4 (OLFM4) Polyclonal Antibody (Mouse), APC

  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OLFM4 (Cys238~Thr500)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Olfactomedin 4 (OLFM4). This antibody is labeled with APC.

Olfactomedin 4 (OLFM4) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OLFM4 (Cys238~Thr500)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Olfactomedin 4 (OLFM4). This antibody is labeled with Biotin.

Olfactomedin 4 (OLFM4) Polyclonal Antibody (Mouse), Cy3

  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OLFM4 (Cys238~Thr500)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Olfactomedin 4 (OLFM4). This antibody is labeled with Cy3.

Olfactomedin 4 (OLFM4) Polyclonal Antibody (Mouse), FITC

  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OLFM4 (Cys238~Thr500)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Olfactomedin 4 (OLFM4). This antibody is labeled with FITC.

Olfactomedin 4 (OLFM4) Polyclonal Antibody (Mouse), HRP

  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OLFM4 (Cys238~Thr500)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Olfactomedin 4 (OLFM4). This antibody is labeled with HRP.

Olfactomedin 4 (OLFM4) Polyclonal Antibody (Mouse), PE

  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OLFM4 (Cys238~Thr500)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Olfactomedin 4 (OLFM4). This antibody is labeled with PE.

Olfactomedin 4 (OLFM4) Polyclonal Antibody (Rat), APC

  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OLFM4 (Ile405~Val511)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Olfactomedin 4 (OLFM4). This antibody is labeled with APC.

Olfactomedin 4 (OLFM4) Polyclonal Antibody (Rat), Biotinylated

  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OLFM4 (Ile405~Val511)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Olfactomedin 4 (OLFM4). This antibody is labeled with Biotin.

Olfactomedin 4 (OLFM4) Polyclonal Antibody (Rat), Cy3

  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OLFM4 (Ile405~Val511)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Olfactomedin 4 (OLFM4). This antibody is labeled with Cy3.

Olfactomedin 4 (OLFM4) Polyclonal Antibody (Rat), FITC

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OLFM4 (Ile405~Val511)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Olfactomedin 4 (OLFM4). This antibody is labeled with FITC.

Olfactomedin 4 (OLFM4) Polyclonal Antibody (Rat), HRP

  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OLFM4 (Ile405~Val511)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Olfactomedin 4 (OLFM4). This antibody is labeled with HRP.

Olfactomedin 4 (OLFM4) Polyclonal Antibody (Rat), PE

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OLFM4 (Ile405~Val511)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Olfactomedin 4 (OLFM4). This antibody is labeled with PE.

Olfactomedin 4 (OLFM4) Polyclonal Antibody (Human), APC-Cy7

  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OLFM4 (Ile407~Gln510)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Olfactomedin 4 (OLFM4). This antibody is labeled with APC-Cy7.

Olfactomedin 4 (OLFM4) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OLFM4 (Cys238~Thr500)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Olfactomedin 4 (OLFM4). This antibody is labeled with APC-Cy7.

Olfactomedin 4 (OLFM4) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OLFM4 (Ile405~Val511)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Olfactomedin 4 (OLFM4). This antibody is labeled with APC-Cy7.

Human Olfactomedin 4 ELISA kit

E01O0016-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Olfactomedin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Olfactomedin 4 ELISA kit

E01O0016-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Olfactomedin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Olfactomedin 4 ELISA kit

E01O0016-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Olfactomedin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Olfactomedin 4 ELISA kit

E02O0016-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Olfactomedin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Olfactomedin 4 ELISA kit

E02O0016-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Olfactomedin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Olfactomedin 4 ELISA kit

E02O0016-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Olfactomedin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Olfactomedin 4 ELISA kit

E04O0016-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Olfactomedin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Olfactomedin 4 ELISA kit

E04O0016-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Olfactomedin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Olfactomedin 4 ELISA kit

E04O0016-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Olfactomedin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Olfactomedin 4 ELISA kit

E03O0016-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Olfactomedin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Olfactomedin 4 ELISA kit

E03O0016-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Olfactomedin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Olfactomedin 4 ELISA kit

E03O0016-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Olfactomedin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Olfactomedin 4 ELISA kit

E08O0016-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Olfactomedin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Olfactomedin 4 ELISA kit

E08O0016-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Olfactomedin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Olfactomedin 4 ELISA kit

E08O0016-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Olfactomedin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Olfactomedin 4 ELISA kit

E07O0016-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Olfactomedin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Olfactomedin 4 ELISA kit

E07O0016-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Olfactomedin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Olfactomedin 4 ELISA kit

E07O0016-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Olfactomedin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Olfactomedin 4 ELISA kit

E06O0016-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Olfactomedin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Olfactomedin 4 ELISA kit

E06O0016-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Olfactomedin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Olfactomedin 4 ELISA kit

E06O0016-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Olfactomedin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Olfactomedin 4 ELISA kit

E09O0016-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Olfactomedin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Olfactomedin 4 ELISA kit

E09O0016-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Olfactomedin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Olfactomedin 4 ELISA kit

E09O0016-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Olfactomedin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Olfactomedin 4 ELISA kit

E05O0016-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Olfactomedin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Olfactomedin 4 ELISA kit

E05O0016-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Olfactomedin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Olfactomedin 4 ELISA kit

E05O0016-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Olfactomedin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


EHO0023 96Tests
EUR 521


EF007024 96 Tests
EUR 689

Bovine OLFM4 ELISA Kit

EBO0023 96Tests
EUR 521

Anserini OLFM4 ELISA Kit

EAO0023 96Tests
EUR 521

Chicken OLFM4 ELISA Kit

ECKO0023 96Tests
EUR 521

Canine OLFM4 ELISA Kit

ECO0023 96Tests
EUR 521


EGTO0023 96Tests
EUR 521

Porcine OLFM4 ELISA Kit

EPO0023 96Tests
EUR 521


ESO0023 96Tests
EUR 521


ERO0023 96Tests
EUR 521

Rabbit OLFM4 ELISA Kit

ERTO0023 96Tests
EUR 521

Monkey OLFM4 ELISA Kit

EMKO0023 96Tests
EUR 521


EMO0023 96Tests
EUR 521

Human OLFM1(Olfactomedin-1) ELISA Kit

EH10762 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Olfactomedin 1 (OLFM1) ELISA Kit

abx381967-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Olfactomedin 2 (OLFM2) ELISA Kit

abx381968-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Olfactomedin 3 (OLFM3) ELISA Kit

abx381969-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Olfactomedin 3(OLFM3)ELISA Kit

QY-E00741 96T
EUR 400

Human Olfactomedin 2(OLFM2)ELISA Kit

QY-E00742 96T
EUR 400

Human Olfactomedin 1(OLFM1)ELISA Kit

QY-E00743 96T
EUR 400

Guinea Pig OLFM4 ELISA Kit

EGO0023 96Tests
EUR 521

Recombinant human OLFM4

P1998 100ug Ask for price
  • Uniprot ID: Q6UX06
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human OLFM4

IL-4 Interleukin 4 Human Recombinant Protein, Yeast

PROTP05112-4 Regular: 10ug
EUR 317
Description: Interleukin-4 Human Recombinant produced in yeast is a single, glycosylated polypeptide chain containing 129 amino acids.;The IL-4 is purified by proprietary chromatographic techniques.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

DLR-CA72-4-Hu-48T 48T
EUR 479
  • Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

DLR-CA72-4-Hu-96T 96T
EUR 621
  • Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

RDR-CA72-4-Hu-48Tests 48 Tests
EUR 500

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

RDR-CA72-4-Hu-96Tests 96 Tests
EUR 692

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

RD-CA72-4-Hu-48Tests 48 Tests
EUR 478

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

RD-CA72-4-Hu-96Tests 96 Tests
EUR 662

OLFM4 antibody

70R-1580 100 ug
EUR 377
Description: Rabbit polyclonal OLFM4 antibody raised against the C terminal of OLFM4

OLFM4 Antibody

40062-100ul 100ul
EUR 252

OLFM4 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OLFM4. Recognizes OLFM4 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500

OLFM4 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against OLFM4. Recognizes OLFM4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

OLFM4 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against OLFM4. Recognizes OLFM4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human FibrOut 4, for brain, neural

4-21552 1 ml Ask for price

Human FibrOut 4, for brain, neural

4-21553 5 x 1 ml Ask for price

Recombinant Human 4-1BB Receptor Protein

PROTQ07011-4 20ug
EUR 317
Description: 4-1BB Receptor, a member of the TNF superfamily of receptors, is mainly expressed on the surface of a variety of T cells, but also found in B cells, monocytes, and various transformed cell lines. 4-1BB Receptor binds to 4-1BBL to provide a co-stimulatory signal for T lymphocytes. Signaling by 4-1BB Receptor has been implicated in the antigen-presentation process and generation of cytotoxic T cells. The human 4-1BB Receptor gene codes for a 255 amino acid type I transmembrane protein containing a 17 amino acid N-terminal signal sequence, a 169 amino acid extracellular domain, a 27 amino acid transmembrane domain and a 42 amino acid cytoplasmic domain. Recombinant human soluble 4-1BB Receptor is a 167 amino acid polypeptide (17.7 kDa), which contains the cysteine rich TNFR-like extracellular domain of 4-1BB Receptor.

Recombinant Human PF-4 (CXCL4) Protein

PROTP02776-4 20ug
EUR 317
Description: PF-4 is a CXC chemokine that is expressed in megakaryocytes and stored in the α-granules of platelets. PF-4 is chemotactic towards neutrophils and monocytes and has been shown to inhibit angiogenesis. Recombinant human PF-4 is a 7.8 kDa protein containing 70 amino acid residues, including the four highly conserved residues present in CXC chemokines.

Human Olfactomedin-like protein 2B(OLFML2B) ELISA kit

CSB-EL016326HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Olfactomedin-like protein 2B (OLFML2B) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Olfactomedin-like protein 2B(OLFML2B) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Olfactomedin-like protein 2B(OLFML2B) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Olfactomedin like protein 2A(OLFML2A) ELISA kit

E01O0734-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Olfactomedin like protein 2A(OLFML2A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Olfactomedin like protein 2A(OLFML2A) ELISA kit

E01O0734-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Olfactomedin like protein 2A(OLFML2A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Olfactomedin like protein 2A(OLFML2A) ELISA kit

E01O0734-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Olfactomedin like protein 2A(OLFML2A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Olfactomedin- like protein 2B, OLFML2B ELISA KIT

ELI-14904h 96 Tests
EUR 824

Human Olfactomedin- like protein 3, OLFML3 ELISA KIT

ELI-23351h 96 Tests
EUR 824

Human Olfactomedin- like protein 2A, OLFML2A ELISA KIT

ELI-35209h 96 Tests
EUR 824

Human Olfactomedin- like protein 1, OLFML1 ELISA KIT

ELI-35527h 96 Tests
EUR 824

Human OLFM4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

OLFM4 Recombinant Protein (Human)

RP041845 100 ug Ask for price

Human CellExp? Olfactomedin, human recombinant

EUR 278

Individual Reaction Mix 4

G065-4 200 reactions
EUR 167

OLFM4 Rabbit pAb

A15387-100ul 100 ul
EUR 308

OLFM4 Rabbit pAb

A15387-200ul 200 ul
EUR 459

OLFM4 Rabbit pAb

A15387-20ul 20 ul
EUR 183

OLFM4 Rabbit pAb

A15387-50ul 50 ul
EUR 223

OLFM4 Blocking Peptide

33R-2362 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of OLFM4 antibody, catalog no. 70R-1580

Anti-OLFM4 Antibody

A04094-1 100ug/vial
EUR 334

OLFM4 Conjugated Antibody

C40062 100ul
EUR 397

OLFM4 cloning plasmid

CSB-CL764941HU-10ug 10ug
EUR 539
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1533
  • Sequence: atgaggcccggcctctcatttctcctagcccttctgttcttccttggccaagctgcaggggatttgggggatgtgggacctccaattcccagccccggcttcagctctttcccaggtgttgactccagctccagcttcagctccagctccaggtcgggctccagctccagccgca
  • Show more
Description: A cloning plasmid for the OLFM4 gene.

OLFM4 Polyclonal Antibody

A68987 100 ?g
EUR 628.55
Description: kits suitable for this type of research

Anti-OLFM4 antibody

STJ117582 100 µl
EUR 277
Description: This gene was originally cloned from human myeloblasts and found to be selectively expressed in inflammed colonic epithelium. This gene encodes a member of the olfactomedin family. The encoded protein is an antiapoptotic factor that promotes tumor growth and is an extracellular matrix glycoprotein that facilitates cell adhesion.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

OLFM4 ORF Vector (Human) (pORF)

ORF013949 1.0 ug DNA
EUR 354

Olfactomedin 1 Protein

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

pLenti-CLDN1 shRNA-4 Plasmid

PVTBAV04867-4 2 ug
EUR 356

Feline IL-4 Recombinant Protein

R00230-4 5ug/vial
EUR 259
Description: IL-4 has many biological roles, including the stimulation of activated B-cell and T-cell proliferation, and the differentiation of CD4+ T-cells into Th2 cells. It is a key regulator in humoral and adaptive immunity. Feline IL-4 Recombinant Protein is purified interleukin-4 produced in yeast.

Human Olfactomedin 3 (OLFM3) Protein

  • EUR 676.00
  • EUR 272.00
  • EUR 2068.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ExoStd? Lyophilized Exosome Standard (30 µg, Human Plasma, 4 vials)

EUR 909

ExoStd? Lyophilized Exosome Standard (100 µg, Human Plasma, 4 vials)

EUR 1137

ExoStd? Lyophilized Exosome Standard (30 µg, Human Serum, 4 vials)

EUR 909

ExoStd? Lyophilized Exosome Standard (100 µg, Human Serum, 4 vials)

EUR 1132

ExoStd? Lyophilized Exosome Standard (30 µg, Human Urine, 4 vials)

EUR 909

ExoStd? Lyophilized Exosome Standard (100 µg, Human Urine, 4 vials)

EUR 1137

ExoStd? Lyophilized Exosome Standard (30 µg, Human Saliva, 4 vials)

EUR 914

ExoStd? Lyophilized Exosome Standard (100 µg, Human Saliva, 4 vials)

EUR 1137

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Rat Olfactomedin like protein 2A(OLFML2A) ELISA kit

E02O0734-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Olfactomedin like protein 2A(OLFML2A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Olfactomedin like protein 2A(OLFML2A) ELISA kit

E02O0734-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Olfactomedin like protein 2A(OLFML2A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Olfactomedin like protein 2A(OLFML2A) ELISA kit

E02O0734-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Olfactomedin like protein 2A(OLFML2A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Olfactomedin like protein 2A(OLFML2A) ELISA kit

E04O0734-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Olfactomedin like protein 2A(OLFML2A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Olfactomedin like protein 2A(OLFML2A) ELISA kit

E04O0734-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Olfactomedin like protein 2A(OLFML2A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Olfactomedin like protein 2A(OLFML2A) ELISA kit

E04O0734-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Olfactomedin like protein 2A(OLFML2A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Olfactomedin like protein 2A(OLFML2A) ELISA kit

E03O0734-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Olfactomedin like protein 2A(OLFML2A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Olfactomedin like protein 2A(OLFML2A) ELISA kit

E03O0734-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Olfactomedin like protein 2A(OLFML2A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Olfactomedin like protein 2A(OLFML2A) ELISA kit

E03O0734-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Olfactomedin like protein 2A(OLFML2A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Olfactomedin like protein 2A(OLFML2A) ELISA kit

E08O0734-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Olfactomedin like protein 2A(OLFML2A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human OLFM4(Olfactomedin 4) ELISA Kit