Human MYOC(Myocilin) ELISA Kit
 ELISA Kit) Human Myocilin (MYOC) ELISA Kit |
|
RD-MYOC-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Myocilin (MYOC) ELISA Kit |
|
RD-MYOC-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
ELISA Kit) Human Myocilin (MYOC)ELISA Kit |
|
201-12-2944 |
SunredBio |
96 tests |
EUR 440 |
- This Myocilin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 ELISA kit) Human Myocilin(MYOC) ELISA kit |
|
CSB-EL015356HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Myocilin (MYOC) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Myocilin(MYOC) ELISA kit |
|
1-CSB-EL015356HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Myocilin(MYOC) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Myocilin (MYOC) ELISA Kit |
|
20-abx152433 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
) Human Myocilin ELISA Kit (MYOC) |
|
RK01914 |
Abclonal |
96 Tests |
EUR 521 |
Human Myocilin (MYOC) ELISA Kit |
|
SEH586Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myocilin (MYOC) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myocilin (MYOC) in tissue homogenates, cell lysates and other biological fluids. |
Human Myocilin (MYOC) ELISA Kit |
|
SEH586Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myocilin (MYOC) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myocilin (MYOC) in tissue homogenates, cell lysates and other biological fluids. |
Human Myocilin (MYOC) ELISA Kit |
|
SEH586Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myocilin (MYOC) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myocilin (MYOC) in tissue homogenates, cell lysates and other biological fluids. |
Human Myocilin (MYOC) ELISA Kit |
|
SEH586Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myocilin (MYOC) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myocilin (MYOC) in tissue homogenates, cell lysates and other biological fluids. |
Human Myocilin (MYOC) ELISA Kit |
|
4-SEH586Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Myocilin elisa. Alternative names of the recognized antigen: GLC1A
- GPOA
- JOAG
- JOAG1
- TIGR
- Trabecular Meshwork Inducible Glucocorticoid Response
- Myocilin 55 kDa subunit
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Myocilin (MYOC) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
 Antibody) Myocilin (MYOC) Antibody |
|
20-abx100274 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Myocilin (MYOC) Antibody |
|
20-abx113919 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Myocilin (MYOC) Antibody |
|
20-abx173661 |
Abbexa |
|
|
|
|
Myocilin (MYOC) Antibody |
|
abx235510-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Myocilin (MYOC) Antibody |
|
20-abx338482 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Myocilin (MYOC) Antibody |
|
20-abx001338 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
) Recombinant Myocilin (MYOC) |
|
4-RPH586Hu01 |
Cloud-Clone |
-
EUR 445.86
-
EUR 222.00
-
EUR 1396.96
-
EUR 532.32
-
EUR 964.64
-
EUR 361.00
-
EUR 3342.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q99972
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 29.1kDa
- Isoelectric Point: 5.4
|
|
Description: Recombinant Human Myocilin expressed in: E.coli |
) ELISA kit for Human MYOC (Myocilin) |
|
ELK3072 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Myocilin (MYOC). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Myocilin (MYOC). N
- Show more
|
|
Description: A sandwich ELISA kit for detection of Myocilin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
) ELISA kit for Human Myocilin (MYOC) |
|
KTE61410-48T |
Abbkine |
48T |
EUR 332 |
- MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Myocilin (MYOC) |
|
KTE61410-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Myocilin (MYOC) |
|
KTE61410-96T |
Abbkine |
96T |
EUR 539 |
- MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 CLIA Kit) Human Myocilin (MYOC) CLIA Kit |
|
20-abx495484 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
 Protein) Human Myocilin (MYOC) Protein |
|
20-abx068136 |
Abbexa |
-
EUR 620.00
-
EUR 272.00
-
EUR 1887.00
-
EUR 746.00
-
EUR 453.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
) ELISA kit for Rat Myocilin (MYOC) |
|
KTE100538-48T |
Abbkine |
48T |
EUR 332 |
- MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rat Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Myocilin (MYOC) |
|
KTE100538-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rat Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Myocilin (MYOC) |
|
KTE100538-96T |
Abbkine |
96T |
EUR 539 |
- MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rat Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
) ELISA kit for Bovine Myocilin (MYOC) |
|
KTE10225-48T |
Abbkine |
48T |
EUR 354 |
- MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Bovine Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Myocilin (MYOC) |
|
KTE10225-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Bovine Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Myocilin (MYOC) |
|
KTE10225-96T |
Abbkine |
96T |
EUR 572 |
- MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Bovine Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
) ELISA kit for Canine Myocilin (MYOC) |
|
KTE20051-48T |
Abbkine |
48T |
EUR 354 |
- MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Canine Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Canine Myocilin (MYOC) |
|
KTE20051-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Canine Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Canine Myocilin (MYOC) |
|
KTE20051-96T |
Abbkine |
96T |
EUR 572 |
- MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Canine Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
) ELISA kit for Mouse Myocilin (MYOC) |
|
KTE70859-48T |
Abbkine |
48T |
EUR 332 |
- MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Myocilin (MYOC) |
|
KTE70859-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Myocilin (MYOC) |
|
KTE70859-96T |
Abbkine |
96T |
EUR 539 |
- MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 Antibody (HRP)) Myocilin (MYOC) Antibody (HRP) |
|
20-abx336634 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Myocilin (MYOC) Antibody (FITC) |
|
20-abx336635 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Myocilin (MYOC) Antibody (Biotin) |
|
20-abx336636 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 polyclonal antibody) Myocilin (MYOC) polyclonal antibody |
|
ABP-PAB-11175 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Neuroscience
- Brand:
|
Myocilin (MYOC) polyclonal antibody |
|
ABP-PAB-11176 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Neuroscience
- Brand:
|
 Polyclonal Antibody (Human)) Myocilin (MYOC) Polyclonal Antibody (Human) |
|
4-PAH586Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MYOC (Ala224~Tyr471)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Myocilin (MYOC) |
 Polyclonal Antibody (Human), APC) Myocilin (MYOC) Polyclonal Antibody (Human), APC |
|
4-PAH586Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MYOC (Ala224~Tyr471)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Myocilin (MYOC). This antibody is labeled with APC. |
 Polyclonal Antibody (Human), Biotinylated) Myocilin (MYOC) Polyclonal Antibody (Human), Biotinylated |
|
4-PAH586Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MYOC (Ala224~Tyr471)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Myocilin (MYOC). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human), Cy3) Myocilin (MYOC) Polyclonal Antibody (Human), Cy3 |
|
4-PAH586Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MYOC (Ala224~Tyr471)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Myocilin (MYOC). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human), FITC) Myocilin (MYOC) Polyclonal Antibody (Human), FITC |
|
4-PAH586Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MYOC (Ala224~Tyr471)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Myocilin (MYOC). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human), HRP) Myocilin (MYOC) Polyclonal Antibody (Human), HRP |
|
4-PAH586Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MYOC (Ala224~Tyr471)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Myocilin (MYOC). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human), PE) Myocilin (MYOC) Polyclonal Antibody (Human), PE |
|
4-PAH586Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MYOC (Ala224~Tyr471)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Myocilin (MYOC). This antibody is labeled with PE. |
 Polyclonal Antibody (Human), APC-Cy7) Myocilin (MYOC) Polyclonal Antibody (Human), APC-Cy7 |
|
4-PAH586Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MYOC (Ala224~Tyr471)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Myocilin (MYOC). This antibody is labeled with APC-Cy7. |
, Clone: 4F8) Monoclonal MYOC / Myocilin Antibody (clone 4F8), Clone: 4F8 |
|
AMM06528G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A Monoclonal antibody against Human MYOC / Myocilin (clone 4F8). The antibodies are raised in Mouse and are from clone 4F8. This antibody is applicable in WB and IHC-P, E, RNAi |
 anti-Myocilin |
|
YF-PA13318 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to Myocilin |
anti-Myocilin |
|
YF-PA13319 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to Myocilin |
 Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
|
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
 MYOC antibody |
|
70R-18728 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal MYOC antibody |
MYOC antibody |
|
38261-100ul |
SAB |
100ul |
EUR 252 |
 MYOC Antibody |
|
1-CSB-PA859950LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against MYOC. Recognizes MYOC from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500 |
MYOC Antibody |
|
DF6483 |
Affbiotech |
200ul |
EUR 304 |
|
Description: MYOC Antibody detects endogenous levels of total MYOC. |
MYOC Antibody |
|
1-CSB-PA015356GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against MYOC. Recognizes MYOC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
 MYOC siRNA |
|
20-abx903437 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MYOC siRNA |
|
20-abx925236 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MYOC siRNA |
|
20-abx925237 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti- Myocilin antibody |
|
FNab05510 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: myocilin, trabecular meshwork inducible glucocorticoid response
- Uniprot ID: Q99972
- Research Area: Neuroscience, Stem Cells, Signal Transduction
|
|
Description: Antibody raised against Myocilin |
) Anti-Myocilin (4F8) |
|
YF-MA10605 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse monoclonal to Myocilin |
) Anti-Myocilin (2B4) |
|
YF-MA14364 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Myocilin |
 Human MYOC shRNA Plasmid |
|
20-abx953076 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) MYOC Recombinant Protein (Human) |
|
RP020554 |
ABM |
100 ug |
Ask for price |
 MYOC Rabbit pAb |
|
A1589-100ul |
Abclonal |
100 ul |
EUR 308 |
MYOC Rabbit pAb |
|
A1589-200ul |
Abclonal |
200 ul |
EUR 459 |
MYOC Rabbit pAb |
|
A1589-20ul |
Abclonal |
20 ul |
EUR 183 |
MYOC Rabbit pAb |
|
A1589-50ul |
Abclonal |
50 ul |
EUR 223 |
 MYOC Blocking Peptide |
|
DF6483-BP |
Affbiotech |
1mg |
EUR 195 |
 MYOC Conjugated Antibody |
|
C38261 |
SAB |
100ul |
EUR 397 |
 MYOC cloning plasmid |
|
CSB-CL859950HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1515
- Sequence: atgaggttcttctgtgcacgttgctgcagctttgggcctgagatgccagctgtccagctgctgcttctggcctgcctggtgtgggatgtgggggccaggacagctcagctcaggaaggccaatgaccagagtggccgatgccagtataccttcagtgtggccagtcccaatgaat
- Show more
|
|
Description: A cloning plasmid for the MYOC gene. |
 MYOC Polyclonal Antibody |
|
ABP59382-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human MYOC protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MYOC from Human, Mouse, Rat. This MYOC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYOC protein |
MYOC Polyclonal Antibody |
|
ABP59382-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human MYOC protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MYOC from Human, Mouse, Rat. This MYOC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYOC protein |
MYOC Polyclonal Antibody |
|
ABP59382-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MYOC protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MYOC from Human, Mouse, Rat. This MYOC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYOC protein |
MYOC Polyclonal Antibody |
|
ES10926-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MYOC from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MYOC Polyclonal Antibody |
|
ES10926-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MYOC from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 Anti-MYOC antibody |
|
STJ24669 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible response protein (TIGR). The trabecular meshwork is a specialized eye tissue essential in regulating intraocular pressure, and mutations in MYOC have been identified as the cause of hereditary juvenile-onset open-angle glaucoma. |
Anti-MYOC antibody |
|
STJ192084 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to MYOC |
 (pORF)) MYOC ORF Vector (Human) (pORF) |
|
ORF006852 |
ABM |
1.0 ug DNA |
EUR 95 |
 Frit Kit |
|
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
|
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
 Column Packing Kit |
|
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
|
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
 PCR Mycoplasma Detection Kit |
|
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
 MYOC Antibody, HRP conjugated |
|
1-CSB-PA859950LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against MYOC. Recognizes MYOC from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 MYOC Antibody, FITC conjugated |
|
1-CSB-PA859950LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against MYOC. Recognizes MYOC from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 MYOC Antibody, Biotin conjugated |
|
1-CSB-PA859950LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against MYOC. Recognizes MYOC from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 Mouse MYOC shRNA Plasmid |
|
20-abx971664 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Rat MYOC shRNA Plasmid |
|
20-abx986600 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) MYOC Recombinant Protein (Mouse) |
|
RP152759 |
ABM |
100 ug |
Ask for price |
) MYOC Recombinant Protein (Rat) |
|
RP213059 |
ABM |
100 ug |
Ask for price |
) MYOC sgRNA CRISPR Lentivector set (Human) |
|
K1380401 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
|
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
|
 CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
|
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
|
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
|
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
) T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
|
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
|
-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
|
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
|
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
|
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 [His]) Human Myocilin Protein (Arg 33-Met 504) [His] |
|
VAng-2579Lsx-1mg |
Creative Biolabs |
1 mg |
EUR 5494 |
|
Description: Human Myocilin (MYOC) protein, His tag, was expressed in human 293 cells. (Uniprot ID: NP_000252) |
Human Myocilin Protein (Arg 33-Met 504) [His] |
|
VAng-2579Lsx-50g |
Creative Biolabs |
50 µg |
EUR 903 |
|
Description: Human Myocilin (MYOC) protein, His tag, was expressed in human 293 cells. (Uniprot ID: NP_000252) |
Human MYOC(Myocilin) ELISA Kit
ELISA Kit)
)
)
