Human MYOC(Myocilin) ELISA Kit

Human MYOC(Myocilin) ELISA Kit

Human Myocilin (MYOC) ELISA Kit
RD-MYOC-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Myocilin (MYOC) ELISA Kit
RD-MYOC-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Myocilin (MYOC)ELISA Kit
201-12-2944	SunredBio	96 tests	EUR 440
This Myocilin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Myocilin(MYOC) ELISA kit
CSB-EL015356HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Myocilin (MYOC) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Myocilin(MYOC) ELISA kit
1-CSB-EL015356HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Myocilin(MYOC) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Myocilin (MYOC) ELISA Kit
20-abx152433	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Myocilin, MYOC ELISA KIT
ELI-12967h	Lifescience Market	96 Tests	EUR 824

Human Myocilin(MYOC)ELISA Kit
QY-E03010	Qayee Biotechnology	96T	EUR 400

Human Myocilin ELISA Kit (MYOC)
RK01914	Abclonal	96 Tests	EUR 521

Human Myocilin (MYOC) ELISA Kit
SEH586Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myocilin (MYOC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myocilin (MYOC) in tissue homogenates, cell lysates and other biological fluids.

Human Myocilin (MYOC) ELISA Kit
SEH586Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myocilin (MYOC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myocilin (MYOC) in tissue homogenates, cell lysates and other biological fluids.

Human Myocilin (MYOC) ELISA Kit
SEH586Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myocilin (MYOC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myocilin (MYOC) in tissue homogenates, cell lysates and other biological fluids.

Human Myocilin (MYOC) ELISA Kit
SEH586Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myocilin (MYOC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myocilin (MYOC) in tissue homogenates, cell lysates and other biological fluids.

Human Myocilin (MYOC) ELISA Kit
4-SEH586Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Myocilin elisa. Alternative names of the recognized antigen: GLC1A GPOA JOAG JOAG1 TIGR Trabecular Meshwork Inducible Glucocorticoid Response Myocilin 55 kDa subunit
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Myocilin (MYOC) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Canine Myocilin, MYOC ELISA KIT
ELI-16637d	Lifescience Market	96 Tests	EUR 928

Bovine Myocilin, MYOC ELISA KIT
ELI-22829b	Lifescience Market	96 Tests	EUR 928

Rabbit Myocilin, MYOC ELISA KIT
ELI-42463Ra	Lifescience Market	96 Tests	EUR 928

Mouse Myocilin, Myoc ELISA KIT
ELI-37461m	Lifescience Market	96 Tests	EUR 865

Rat Myocilin, Myoc ELISA KIT
ELI-37462r	Lifescience Market	96 Tests	EUR 886

Myocilin (MYOC) Antibody
20-abx100274	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Myocilin (MYOC) Antibody
20-abx113919	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Myocilin (MYOC) Antibody
20-abx173661	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Myocilin (MYOC) Antibody
abx235510-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Myocilin (MYOC) Antibody
20-abx338482	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Myocilin (MYOC) Antibody
20-abx001338	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Recombinant Myocilin (MYOC)
4-RPH586Hu01	Cloud-Clone	EUR 445.86 EUR 222.00 EUR 1396.96 EUR 532.32 EUR 964.64 EUR 361.00 EUR 3342.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q99972 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.1kDa Isoelectric Point: 5.4
Description: Recombinant Human Myocilin expressed in: E.coli

ELISA kit for Human MYOC (Myocilin)
ELK3072	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Myocilin (MYOC). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Myocilin (MYOC). N Show more
Description: A sandwich ELISA kit for detection of Myocilin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Myocilin (MYOC)
KTE61410-48T	Abbkine	48T	EUR 332
MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon Show more
Description: Quantitative sandwich ELISA for measuring Human Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Myocilin (MYOC)
KTE61410-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon Show more
Description: Quantitative sandwich ELISA for measuring Human Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Myocilin (MYOC)
KTE61410-96T	Abbkine	96T	EUR 539
MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon Show more
Description: Quantitative sandwich ELISA for measuring Human Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Myocilin (MYOC) CLIA Kit
20-abx495484	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Myocilin (MYOC) Protein
20-abx068136	Abbexa	EUR 620.00 EUR 272.00 EUR 1887.00 EUR 746.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

ELISA kit for Rat Myocilin (MYOC)
KTE100538-48T	Abbkine	48T	EUR 332
MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon Show more
Description: Quantitative sandwich ELISA for measuring Rat Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Myocilin (MYOC)
KTE100538-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon Show more
Description: Quantitative sandwich ELISA for measuring Rat Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Myocilin (MYOC)
KTE100538-96T	Abbkine	96T	EUR 539
MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon Show more
Description: Quantitative sandwich ELISA for measuring Rat Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Myocilin (MYOC)
KTE10225-48T	Abbkine	48T	EUR 354
MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon Show more
Description: Quantitative sandwich ELISA for measuring Bovine Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Myocilin (MYOC)
KTE10225-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon Show more
Description: Quantitative sandwich ELISA for measuring Bovine Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Myocilin (MYOC)
KTE10225-96T	Abbkine	96T	EUR 572
MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon Show more
Description: Quantitative sandwich ELISA for measuring Bovine Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Myocilin (MYOC)
KTE20051-48T	Abbkine	48T	EUR 354
MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon Show more
Description: Quantitative sandwich ELISA for measuring Canine Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Myocilin (MYOC)
KTE20051-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon Show more
Description: Quantitative sandwich ELISA for measuring Canine Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Myocilin (MYOC)
KTE20051-96T	Abbkine	96T	EUR 572
MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon Show more
Description: Quantitative sandwich ELISA for measuring Canine Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Myocilin (MYOC)
KTE70859-48T	Abbkine	48T	EUR 332
MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon Show more
Description: Quantitative sandwich ELISA for measuring Mouse Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Myocilin (MYOC)
KTE70859-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon Show more
Description: Quantitative sandwich ELISA for measuring Mouse Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Myocilin (MYOC)
KTE70859-96T	Abbkine	96T	EUR 539
MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon Show more
Description: Quantitative sandwich ELISA for measuring Mouse Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Myocilin (MYOC) Antibody (HRP)
20-abx336634	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Myocilin (MYOC) Antibody (FITC)
20-abx336635	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Myocilin (MYOC) Antibody (Biotin)
20-abx336636	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Myocilin (MYOC) polyclonal antibody
ABP-PAB-11175	Allele Biotech	100 ug	Ask for price
Product line: Neuroscience Brand:

Myocilin (MYOC) polyclonal antibody
ABP-PAB-11176	Allele Biotech	100 ug	Ask for price
Product line: Neuroscience Brand:

Myocilin (MYOC) Polyclonal Antibody (Human)
4-PAH586Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MYOC (Ala224~Tyr471) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myocilin (MYOC)

Myocilin (MYOC) Polyclonal Antibody (Human), APC
4-PAH586Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MYOC (Ala224~Tyr471) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myocilin (MYOC). This antibody is labeled with APC.

Myocilin (MYOC) Polyclonal Antibody (Human), Biotinylated
4-PAH586Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MYOC (Ala224~Tyr471) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myocilin (MYOC). This antibody is labeled with Biotin.

Myocilin (MYOC) Polyclonal Antibody (Human), Cy3
4-PAH586Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MYOC (Ala224~Tyr471) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myocilin (MYOC). This antibody is labeled with Cy3.

Myocilin (MYOC) Polyclonal Antibody (Human), FITC
4-PAH586Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MYOC (Ala224~Tyr471) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myocilin (MYOC). This antibody is labeled with FITC.

Myocilin (MYOC) Polyclonal Antibody (Human), HRP
4-PAH586Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MYOC (Ala224~Tyr471) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myocilin (MYOC). This antibody is labeled with HRP.

Myocilin (MYOC) Polyclonal Antibody (Human), PE
4-PAH586Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MYOC (Ala224~Tyr471) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myocilin (MYOC). This antibody is labeled with PE.

Myocilin (MYOC) Polyclonal Antibody (Human), APC-Cy7
4-PAH586Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MYOC (Ala224~Tyr471) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myocilin (MYOC). This antibody is labeled with APC-Cy7.

Monoclonal MYOC / Myocilin Antibody (clone 4F8), Clone: 4F8
AMM06528G	Leading Biology	0.05mg	EUR 528
Description: A Monoclonal antibody against Human MYOC / Myocilin (clone 4F8). The antibodies are raised in Mouse and are from clone 4F8. This antibody is applicable in WB and IHC-P, E, RNAi

Myocilin ELISA KIT|Human
EF001052	Lifescience Market	96 Tests	EUR 689

MYOC ELISA Kit (Human) (OKCD01267)
OKCD01267	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Secreted glycoprotein regulating the activation of different signaling pathways in adjacent cells to control different processes including cell adhesion, cell-matrix adhesion, cytoskeleton organization and cell migration. Promotes substrate adhesion, spreading and formation of focal contacts. Negatively regulates cell-matrix adhesion and stress fiber assembly through Rho protein signal transduction. Modulates the organization of actin cytoskeleton by stimulating the formation of stress fibers through interactions with components of Wnt signaling pathways. Promotes cell migration through activation of PTK2 and the downstream phosphatidylinositol 3-kinase signaling. Plays a role in bone formation and promotes osteoblast differentiation in a dose-dependent manner through mitogen-activated protein kinase signaling. Mediates myelination in the peripheral nervous system through ERBB2/ERBB3 signaling. Plays a role as a regulator of muscle hypertrophy through the components of dystrophin-associated protein complex. Involved in positive regulation of mitochondrial depolarization. Plays a role in neurite outgrowth. May participate in the obstruction of fluid outflow in the trabecular meshwork.By similarity <p>Manually curated information which has been propagated from a related experimentally characterized protein.</p> <p><a href="/manual/evidences#ECO:0000250">More…</a></p> Manual assertion inferred from sequence similarity toiUniProtKB:O70624 (MYOC_MOUSE)8 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.24"Mitochondrial association of myocilin, product of a glaucoma gene, in human trabecular meshwork cells."_x005F_x005F_x000D_Sakai H., Shen X., Koga T., Park B.C., Noskina Y., Tibudan M., Yue B.Y._x005F_x005F_x000D_J. Cell. Physiol. 213:775-784(2007) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION IN MITOCHONDRIAL DEPOLARIZATION, SUBCELLULAR LOCATION.Ref.25"Rho GTPase and cAMP/protein kinase A signaling mediates myocilin-induced alterations in cultured human trabecular meshwork cells."_x005F_x005F_x000D_Shen X., Koga T., Park B.C., SundarRaj N., Yue B.Y._x005F_x005F_x000D_J. Biol. Chem. 283:603-612(2008) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION IN CELL-MATRIX ADHESION.Ref.26"Myocilin promotes substrate adhesion, spreading and formation of focal contacts in podocytes and mesangial cells."_x005F_x005F_x000D_Goldwich A., Scholz M., Tamm E.R._x005F_x005F_x000D_Histochem. Cell Biol. 131:167-180(2009) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION IN CELL ADHESION.Ref.27"Myocilin is a modulator of Wnt signaling."_x005F_x005F_x000D_Kwon H.S., Lee H.S., Ji Y., Rubin J.S., Tomarev S.I._x005F_x005F_x000D_Mol. Cell. Biol. 29:2139-2154(2009) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION IN STRESS FIBER ASSEMBLY, INTERACTION WITH FRZB; FZD7; FZD10; FZD1 AND WIF1, CHARACTERIZATION OF VARIANT ASN-477.Ref.28"Differential effects of myocilin and optineurin, two glaucoma genes, on neurite outgrowth."_x005F_x005F_x000D_Koga T., Shen X., Park J.S., Qiu Y., Park B.C., Shyam R., Yue B.Y._x005F_x005F_x000D_Am. J. Pathol. 176:343-352(2010) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION IN NEURITE OUTGROWTH.Ref.29"Myocilin, a glaucoma-associated protein, promotes cell migration through activation of integrin-focal adhesion kinase-serine/threonine kinase signaling pathway."_x005F_x005F_x000D_Kwon H.S., Tomarev S.I._x005F_x005F_x000D_J. Cell. Physiol. 226:3392-3402(2011) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION IN CELL MIGRATION.Ref.30"Myocilin stimulates osteogenic differentiation of mesenchymal stem cells through mitogen-activated protein kinase signaling."_x005F_x005F_x000D_Kwon H.S., Johnson T.V., Tomarev S.I._x005F_x005F_x000D_J. Biol. Chem. 288:16882-16894(2013) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION IN OSTEOBLAST DIFFERENTIATION.Ref.31"Myocilin mediates myelination in the peripheral nervous system through ErbB2/3 signaling."_x005F_x005F_x000D_Kwon H.S., Johnson T.V., Joe M.K., Abu-Asab M., Zhang J., Chan C.C., Tomarev S.I._x005F_x005F_x000D_J. Biol. Chem. 288:26357-26371(2013) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION IN MYELINATION, INTERACTION WITH NFASC; GLDN AND NRCAM. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.26 ng/mL

anti-Myocilin
YF-PA13318	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to Myocilin

anti-Myocilin
YF-PA13319	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to Myocilin

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

MYOC antibody
70R-18728	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal MYOC antibody

MYOC antibody
38261-100ul	SAB	100ul	EUR 252

MYOC Antibody
1-CSB-PA859950LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYOC. Recognizes MYOC from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500

MYOC Antibody
DF6483	Affbiotech	200ul	EUR 304
Description: MYOC Antibody detects endogenous levels of total MYOC.

MYOC Antibody
1-CSB-PA015356GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MYOC. Recognizes MYOC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MYOC siRNA
20-abx903437	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MYOC siRNA
20-abx925236	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MYOC siRNA
20-abx925237	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MYOC Antibody
ABD6483	Lifescience Market	100 ug	EUR 438

anti- Myocilin antibody
FNab05510	FN Test	100µg	EUR 505.25
Immunogen: myocilin, trabecular meshwork inducible glucocorticoid response Uniprot ID: Q99972 Research Area: Neuroscience, Stem Cells, Signal Transduction
Description: Antibody raised against Myocilin

Anti-Myocilin antibody
PAab05510	Lifescience Market	100 ug	EUR 355

Anti-Myocilin (4F8)
YF-MA10605	Abfrontier	50 ug	EUR 363
Description: Mouse monoclonal to Myocilin

Anti-Myocilin (2B4)
YF-MA14364	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Myocilin

Human MYOC shRNA Plasmid
20-abx953076	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MYOC Recombinant Protein (Human)
RP020554	ABM	100 ug	Ask for price

MYOC Rabbit pAb
A1589-100ul	Abclonal	100 ul	EUR 308

MYOC Rabbit pAb
A1589-200ul	Abclonal	200 ul	EUR 459

MYOC Rabbit pAb
A1589-20ul	Abclonal	20 ul	EUR 183

MYOC Rabbit pAb
A1589-50ul	Abclonal	50 ul	EUR 223

MYOC Blocking Peptide
DF6483-BP	Affbiotech	1mg	EUR 195

MYOC Conjugated Antibody
C38261	SAB	100ul	EUR 397

MYOC cloning plasmid
CSB-CL859950HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1515 Sequence: atgaggttcttctgtgcacgttgctgcagctttgggcctgagatgccagctgtccagctgctgcttctggcctgcctggtgtgggatgtgggggccaggacagctcagctcaggaaggccaatgaccagagtggccgatgccagtataccttcagtgtggccagtcccaatgaat Show more
Description: A cloning plasmid for the MYOC gene.

MYOC Polyclonal Antibody
ABP59382-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human MYOC protein Applications tips:
Description: A polyclonal antibody for detection of MYOC from Human, Mouse, Rat. This MYOC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYOC protein

MYOC Polyclonal Antibody
ABP59382-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human MYOC protein Applications tips:
Description: A polyclonal antibody for detection of MYOC from Human, Mouse, Rat. This MYOC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYOC protein

MYOC Polyclonal Antibody
ABP59382-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human MYOC protein Applications tips:
Description: A polyclonal antibody for detection of MYOC from Human, Mouse, Rat. This MYOC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYOC protein

MYOC Polyclonal Antibody
ES10926-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MYOC from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MYOC Polyclonal Antibody
ES10926-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MYOC from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-MYOC antibody
STJ24669	St John's Laboratory	100 µl	EUR 277
Description: MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible response protein (TIGR). The trabecular meshwork is a specialized eye tissue essential in regulating intraocular pressure, and mutations in MYOC have been identified as the cause of hereditary juvenile-onset open-angle glaucoma.

Anti-MYOC Antibody
STJ501843	St John's Laboratory	100 µg	EUR 476

Anti-MYOC Antibody
STJ501844	St John's Laboratory	100 µg	EUR 476

Anti-MYOC Antibody
STJ501845	St John's Laboratory	100 µg	EUR 476

Anti-MYOC antibody
STJ192084	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to MYOC

MYOC ORF Vector (Human) (pORF)
ORF006852	ABM	1.0 ug DNA	EUR 95

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

MYOC Antibody, HRP conjugated
1-CSB-PA859950LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYOC. Recognizes MYOC from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MYOC Antibody, FITC conjugated
1-CSB-PA859950LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYOC. Recognizes MYOC from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MYOC Antibody, Biotin conjugated
1-CSB-PA859950LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYOC. Recognizes MYOC from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse MYOC shRNA Plasmid
20-abx971664	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat MYOC shRNA Plasmid
20-abx986600	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

pCMV-SPORT6-MYOC Plasmid
PVT16513	Lifescience Market	2 ug	EUR 325

MYOC Recombinant Protein (Mouse)
RP152759	ABM	100 ug	Ask for price

MYOC Recombinant Protein (Rat)
RP213059	ABM	100 ug	Ask for price

Anti-MYOC Antibody (Biotin)
STJ501846	St John's Laboratory	100 µg	EUR 586

Anti-MYOC Antibody (FITC)
STJ501847	St John's Laboratory	100 µg	EUR 586

Anti-MYOC Antibody (Biotin)
STJ501848	St John's Laboratory	100 µg	EUR 586

Anti-MYOC Antibody (FITC)
STJ501849	St John's Laboratory	100 µg	EUR 586

Anti-MYOC Antibody (Biotin)
STJ501850	St John's Laboratory	100 µg	EUR 586

Anti-MYOC Antibody (FITC)
STJ501851	St John's Laboratory	100 µg	EUR 586

Rabbit Anti-Human MYOC polyclonal antibody
CABT-BL009	Creative Diagnostics	100 ul	EUR 585

MYOC sgRNA CRISPR Lentivector set (Human)
K1380401	ABM	3 x 1.0 ug	EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Human Myocilin Protein (Arg 33-Met 504) [His]
VAng-2579Lsx-1mg	Creative Biolabs	1 mg	EUR 5494
Description: Human Myocilin (MYOC) protein, His tag, was expressed in human 293 cells. (Uniprot ID: NP_000252)

Human MYOC(Myocilin) ELISA Kit