Human MYOC(Myocilin) ELISA Kit

Human MYOC(Myocilin) ELISA Kit

Human Myocilin (MYOC) ELISA Kit

RD-MYOC-Hu-48Tests 48 Tests
EUR 521

Human Myocilin (MYOC) ELISA Kit

RD-MYOC-Hu-96Tests 96 Tests
EUR 723

Human Myocilin (MYOC)ELISA Kit

201-12-2944 96 tests
EUR 440
  • This Myocilin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Myocilin(MYOC) ELISA kit

CSB-EL015356HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Myocilin (MYOC) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Myocilin(MYOC) ELISA kit

1-CSB-EL015356HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Myocilin(MYOC) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Myocilin (MYOC) ELISA Kit

20-abx152433
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Myocilin, MYOC ELISA KIT

ELI-12967h 96 Tests
EUR 824

Human Myocilin(MYOC)ELISA Kit

QY-E03010 96T
EUR 400

Human Myocilin ELISA Kit (MYOC)

RK01914 96 Tests
EUR 521

Human Myocilin (MYOC) ELISA Kit

SEH586Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myocilin (MYOC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myocilin (MYOC) in tissue homogenates, cell lysates and other biological fluids.

Human Myocilin (MYOC) ELISA Kit

SEH586Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myocilin (MYOC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myocilin (MYOC) in tissue homogenates, cell lysates and other biological fluids.

Human Myocilin (MYOC) ELISA Kit

SEH586Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myocilin (MYOC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myocilin (MYOC) in tissue homogenates, cell lysates and other biological fluids.

Human Myocilin (MYOC) ELISA Kit

SEH586Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myocilin (MYOC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myocilin (MYOC) in tissue homogenates, cell lysates and other biological fluids.

Human Myocilin (MYOC) ELISA Kit

4-SEH586Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Myocilin elisa. Alternative names of the recognized antigen: GLC1A
  • GPOA
  • JOAG
  • JOAG1
  • TIGR
  • Trabecular Meshwork Inducible Glucocorticoid Response
  • Myocilin 55 kDa subunit
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Myocilin (MYOC) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Canine Myocilin, MYOC ELISA KIT

ELI-16637d 96 Tests
EUR 928

Bovine Myocilin, MYOC ELISA KIT

ELI-22829b 96 Tests
EUR 928

Rabbit Myocilin, MYOC ELISA KIT

ELI-42463Ra 96 Tests
EUR 928

Mouse Myocilin, Myoc ELISA KIT

ELI-37461m 96 Tests
EUR 865

Rat Myocilin, Myoc ELISA KIT

ELI-37462r 96 Tests
EUR 886

Myocilin (MYOC) Antibody

20-abx100274
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myocilin (MYOC) Antibody

20-abx113919
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myocilin (MYOC) Antibody

20-abx173661
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Myocilin (MYOC) Antibody

abx235510-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Myocilin (MYOC) Antibody

20-abx338482
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Myocilin (MYOC) Antibody

20-abx001338
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Myocilin (MYOC)

4-RPH586Hu01
  • EUR 445.86
  • EUR 222.00
  • EUR 1396.96
  • EUR 532.32
  • EUR 964.64
  • EUR 361.00
  • EUR 3342.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q99972
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.1kDa
  • Isoelectric Point: 5.4
Description: Recombinant Human Myocilin expressed in: E.coli

ELISA kit for Human MYOC (Myocilin)

ELK3072 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Myocilin (MYOC). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Myocilin (MYOC). N
  • Show more
Description: A sandwich ELISA kit for detection of Myocilin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Myocilin (MYOC)

KTE61410-48T 48T
EUR 332
  • MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Myocilin (MYOC)

KTE61410-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Myocilin (MYOC)

KTE61410-96T 96T
EUR 539
  • MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Myocilin (MYOC) CLIA Kit

20-abx495484
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Myocilin (MYOC) Protein

20-abx068136
  • EUR 620.00
  • EUR 272.00
  • EUR 1887.00
  • EUR 746.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

ELISA kit for Rat Myocilin (MYOC)

KTE100538-48T 48T
EUR 332
  • MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Myocilin (MYOC)

KTE100538-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Myocilin (MYOC)

KTE100538-96T 96T
EUR 539
  • MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Myocilin (MYOC)

KTE10225-48T 48T
EUR 354
  • MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Myocilin (MYOC)

KTE10225-5platesof96wells 5 plates of 96 wells
EUR 2252
  • MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Myocilin (MYOC)

KTE10225-96T 96T
EUR 572
  • MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Myocilin (MYOC)

KTE20051-48T 48T
EUR 354
  • MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Myocilin (MYOC)

KTE20051-5platesof96wells 5 plates of 96 wells
EUR 2252
  • MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Myocilin (MYOC)

KTE20051-96T 96T
EUR 572
  • MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Myocilin (MYOC)

KTE70859-48T 48T
EUR 332
  • MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Myocilin (MYOC)

KTE70859-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Myocilin (MYOC)

KTE70859-96T 96T
EUR 539
  • MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible respon
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Myocilin (MYOC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Myocilin (MYOC) Antibody (HRP)

20-abx336634
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Myocilin (MYOC) Antibody (FITC)

20-abx336635
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Myocilin (MYOC) Antibody (Biotin)

20-abx336636
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Myocilin (MYOC) polyclonal antibody

ABP-PAB-11175 100 ug Ask for price
    • Product line: Neuroscience
    • Brand:

Myocilin (MYOC) polyclonal antibody

ABP-PAB-11176 100 ug Ask for price
    • Product line: Neuroscience
    • Brand:

Myocilin (MYOC) Polyclonal Antibody (Human)

4-PAH586Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYOC (Ala224~Tyr471)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myocilin (MYOC)

Myocilin (MYOC) Polyclonal Antibody (Human), APC

4-PAH586Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYOC (Ala224~Tyr471)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myocilin (MYOC). This antibody is labeled with APC.

Myocilin (MYOC) Polyclonal Antibody (Human), Biotinylated

4-PAH586Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYOC (Ala224~Tyr471)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myocilin (MYOC). This antibody is labeled with Biotin.

Myocilin (MYOC) Polyclonal Antibody (Human), Cy3

4-PAH586Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYOC (Ala224~Tyr471)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myocilin (MYOC). This antibody is labeled with Cy3.

Myocilin (MYOC) Polyclonal Antibody (Human), FITC

4-PAH586Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYOC (Ala224~Tyr471)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myocilin (MYOC). This antibody is labeled with FITC.

Myocilin (MYOC) Polyclonal Antibody (Human), HRP

4-PAH586Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYOC (Ala224~Tyr471)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myocilin (MYOC). This antibody is labeled with HRP.

Myocilin (MYOC) Polyclonal Antibody (Human), PE

4-PAH586Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYOC (Ala224~Tyr471)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myocilin (MYOC). This antibody is labeled with PE.

Myocilin (MYOC) Polyclonal Antibody (Human), APC-Cy7

4-PAH586Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYOC (Ala224~Tyr471)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myocilin (MYOC). This antibody is labeled with APC-Cy7.

Monoclonal MYOC / Myocilin Antibody (clone 4F8), Clone: 4F8

AMM06528G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human MYOC / Myocilin (clone 4F8). The antibodies are raised in Mouse and are from clone 4F8. This antibody is applicable in WB and IHC-P, E, RNAi

Myocilin ELISA KIT|Human

EF001052 96 Tests
EUR 689

anti-Myocilin

YF-PA13318 50 ul
EUR 363
Description: Mouse polyclonal to Myocilin

anti-Myocilin

YF-PA13319 100 ug
EUR 403
Description: Rabbit polyclonal to Myocilin

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

MYOC antibody

70R-18728 50 ul
EUR 435
Description: Rabbit polyclonal MYOC antibody

MYOC antibody

38261-100ul 100ul
EUR 252

MYOC Antibody

1-CSB-PA859950LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYOC. Recognizes MYOC from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500

MYOC Antibody

DF6483 200ul
EUR 304
Description: MYOC Antibody detects endogenous levels of total MYOC.

MYOC Antibody

1-CSB-PA015356GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MYOC. Recognizes MYOC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MYOC siRNA

20-abx903437
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MYOC siRNA

20-abx925236
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MYOC siRNA

20-abx925237
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MYOC Antibody

ABD6483 100 ug
EUR 438

anti- Myocilin antibody

FNab05510 100µg
EUR 505.25
  • Immunogen: myocilin, trabecular meshwork inducible glucocorticoid response
  • Uniprot ID: Q99972
  • Research Area: Neuroscience, Stem Cells, Signal Transduction
Description: Antibody raised against Myocilin

Anti-Myocilin antibody

PAab05510 100 ug
EUR 355

Anti-Myocilin (4F8)

YF-MA10605 50 ug
EUR 363
Description: Mouse monoclonal to Myocilin

Anti-Myocilin (2B4)

YF-MA14364 100 ug
EUR 363
Description: Mouse monoclonal to Myocilin

Human MYOC shRNA Plasmid

20-abx953076
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MYOC Recombinant Protein (Human)

RP020554 100 ug Ask for price

MYOC Rabbit pAb

A1589-100ul 100 ul
EUR 308

MYOC Rabbit pAb

A1589-200ul 200 ul
EUR 459

MYOC Rabbit pAb

A1589-20ul 20 ul
EUR 183

MYOC Rabbit pAb

A1589-50ul 50 ul
EUR 223

MYOC Blocking Peptide

DF6483-BP 1mg
EUR 195

MYOC Conjugated Antibody

C38261 100ul
EUR 397

MYOC cloning plasmid

CSB-CL859950HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1515
  • Sequence: atgaggttcttctgtgcacgttgctgcagctttgggcctgagatgccagctgtccagctgctgcttctggcctgcctggtgtgggatgtgggggccaggacagctcagctcaggaaggccaatgaccagagtggccgatgccagtataccttcagtgtggccagtcccaatgaat
  • Show more
Description: A cloning plasmid for the MYOC gene.

MYOC Polyclonal Antibody

ABP59382-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MYOC protein
  • Applications tips:
Description: A polyclonal antibody for detection of MYOC from Human, Mouse, Rat. This MYOC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYOC protein

MYOC Polyclonal Antibody

ABP59382-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MYOC protein
  • Applications tips:
Description: A polyclonal antibody for detection of MYOC from Human, Mouse, Rat. This MYOC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYOC protein

MYOC Polyclonal Antibody

ABP59382-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MYOC protein
  • Applications tips:
Description: A polyclonal antibody for detection of MYOC from Human, Mouse, Rat. This MYOC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYOC protein

MYOC Polyclonal Antibody

ES10926-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MYOC from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MYOC Polyclonal Antibody

ES10926-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MYOC from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-MYOC antibody

STJ24669 100 µl
EUR 277
Description: MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible response protein (TIGR). The trabecular meshwork is a specialized eye tissue essential in regulating intraocular pressure, and mutations in MYOC have been identified as the cause of hereditary juvenile-onset open-angle glaucoma.

Anti-MYOC Antibody

STJ501843 100 µg
EUR 476

Anti-MYOC Antibody

STJ501844 100 µg
EUR 476

Anti-MYOC Antibody

STJ501845 100 µg
EUR 476

Anti-MYOC antibody

STJ192084 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MYOC

MYOC ORF Vector (Human) (pORF)

ORF006852 1.0 ug DNA
EUR 95

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

MYOC Antibody, HRP conjugated

1-CSB-PA859950LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYOC. Recognizes MYOC from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MYOC Antibody, FITC conjugated

1-CSB-PA859950LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYOC. Recognizes MYOC from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MYOC Antibody, Biotin conjugated

1-CSB-PA859950LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYOC. Recognizes MYOC from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse MYOC shRNA Plasmid

20-abx971664
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat MYOC shRNA Plasmid

20-abx986600
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-MYOC Plasmid

PVT16513 2 ug
EUR 325

MYOC Recombinant Protein (Mouse)

RP152759 100 ug Ask for price

MYOC Recombinant Protein (Rat)

RP213059 100 ug Ask for price

Anti-MYOC Antibody (Biotin)

STJ501846 100 µg
EUR 586

Anti-MYOC Antibody (FITC)

STJ501847 100 µg
EUR 586

Anti-MYOC Antibody (Biotin)

STJ501848 100 µg
EUR 586

Anti-MYOC Antibody (FITC)

STJ501849 100 µg
EUR 586

Anti-MYOC Antibody (Biotin)

STJ501850 100 µg
EUR 586

Anti-MYOC Antibody (FITC)

STJ501851 100 µg
EUR 586

Rabbit Anti-Human MYOC polyclonal antibody

CABT-BL009 100 ul
EUR 585

MYOC sgRNA CRISPR Lentivector set (Human)

K1380401 3 x 1.0 ug
EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Human Myocilin Protein (Arg 33-Met 504) [His]

VAng-2579Lsx-1mg 1 mg
EUR 5494
Description: Human Myocilin (MYOC) protein, His tag, was expressed in human 293 cells. (Uniprot ID: NP_000252)

Human Myocilin Protein (Arg 33-Met 504) [His]

VAng-2579Lsx-50g 50 µg
EUR 903
Description: Human Myocilin (MYOC) protein, His tag, was expressed in human 293 cells. (Uniprot ID: NP_000252)

Human MYOC(Myocilin) ELISA Kit