Human EPYC(Epiphycan) ELISA Kit

Human EPYC(Epiphycan) ELISA Kit

Human Epiphycan (EPYC) ELISA Kit

RD-EPYC-Hu-48Tests 48 Tests
EUR 521

Human Epiphycan (EPYC) ELISA Kit

RD-EPYC-Hu-96Tests 96 Tests
EUR 723

Human Epiphycan (EPYC) ELISA Kit

RDR-EPYC-Hu-48Tests 48 Tests
EUR 544

Human Epiphycan (EPYC) ELISA Kit

RDR-EPYC-Hu-96Tests 96 Tests
EUR 756

Human EPYC(Epiphycan) ELISA Kit

EH3009 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q99645
  • Alias: EPYC/PG-Lb/SLRR3B/Dermatan sulfate proteoglycan 3dermatan sulphate proteoglycan 3/DSPG3proteoglycan-lb/epiphycan/PGLB/Pg-Lb/PG-Lb/Proteoglycan-Lb/SLRR3Bepiphycan proteoglycan/Small chondroitin
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Epiphycan, EPYC ELISA KIT

ELI-47275h 96 Tests
EUR 824

Human Epiphycan (EPYC) ELISA Kit

20-abx151434
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Epiphycan (EPYC) ELISA Kit

abx252401-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Epiphycan (EPYC)ELISA Kit

201-12-2676 96 tests
EUR 440
  • This Epiphycan ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Epiphycan(EPYC)ELISA Kit

QY-E03113 96T
EUR 361

Human Epiphycan (EPYC) ELISA Kit

SEJ227Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Epiphycan (EPYC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Epiphycan (EPYC) in Tissue homogenates and other biological fluids.

Human Epiphycan (EPYC) ELISA Kit

SEJ227Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Epiphycan (EPYC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Epiphycan (EPYC) in Tissue homogenates and other biological fluids.

Human Epiphycan (EPYC) ELISA Kit

SEJ227Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Epiphycan (EPYC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Epiphycan (EPYC) in Tissue homogenates and other biological fluids.

Human Epiphycan (EPYC) ELISA Kit

SEJ227Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Epiphycan (EPYC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Epiphycan (EPYC) in Tissue homogenates and other biological fluids.

Human Epiphycan (EPYC) ELISA Kit

4-SEJ227Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Epiphycan elisa. Alternative names of the recognized antigen: DSPG3
  • Pg-Lb
  • SLRR3B
  • Dermatan Sulphate Proteoglycan 3
  • Dermatan Sulfate Proteoglycan 3
  • Proteoglycan-Lb
  • Small chondroitin/dermatan sulfate proteoglycan
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Epiphycan (EPYC) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Bovine Epiphycan, EPYC ELISA KIT

ELI-26891b 96 Tests
EUR 928

Mouse Epiphycan, Epyc ELISA KIT

ELI-32781m 96 Tests
EUR 865

Chicken Epiphycan, EPYC ELISA KIT

ELI-47715c 96 Tests
EUR 928

Chicken Epiphycan (EPYC) ELISA Kit

abx354637-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Epiphycan (EPYC) ELISA Kit

abx354912-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Epiphycan (EPYC) ELISA Kit

abx355061-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Epiphycan (EPYC) ELISA Kit

abx355328-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Epiphycan (EPYC) Antibody

20-abx129601
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Epiphycan (EPYC) Antibody

20-abx100319
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Epiphycan (EPYC) Antibody

20-abx172275
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Epiphycan (EPYC)

4-RPJ227Hu01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q99645
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Epiphycan expressed in: E.coli

Recombinant Epiphycan (EPYC)

4-RPJ227Mu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P70186
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.3kDa
  • Isoelectric Point: 6.9
Description: Recombinant Mouse Epiphycan expressed in: E.coli

ELISA kit for Human EPYC (Epiphycan)

ELK3102 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Epiphycan (EPYC). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Epiphycan (EPYC).
  • Show more
Description: A sandwich ELISA kit for detection of Epiphycan from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human EPYC (Epiphycan)

E-EL-H0370 1 plate of 96 wells
EUR 534
  • Gentaur's EPYC ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human EPYC. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human EPYC (Epiphycan) in samples from Serum, Plasma, Cell supernatant

Human Epiphycan (EPYC) CLIA Kit

abx195548-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Epiphycan (EPYC) CLIA Kit

20-abx495642
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Epiphycan (EPYC) Protein

20-abx066448
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Guinea pig Epiphycan (EPYC) ELISA Kit

abx354871-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Epiphycan (EPYC) Protein

20-abx167271
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

CLIA kit for Human EPYC (Epiphycan)

E-CL-H0301 1 plate of 96 wells
EUR 584
  • Gentaur's EPYC CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human EPYC . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human EPYC (Epiphycan) in samples from Serum, Plasma, Cell supernatant

Epiphycan (EPYC) Polyclonal Antibody (Human)

4-PAJ227Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (His110~Pro317)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC)

Epiphycan (EPYC) Polyclonal Antibody (Human), APC

4-PAJ227Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (His110~Pro317)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with APC.

Epiphycan (EPYC) Polyclonal Antibody (Human), Biotinylated

4-PAJ227Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (His110~Pro317)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with Biotin.

Epiphycan (EPYC) Polyclonal Antibody (Human), Cy3

4-PAJ227Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (His110~Pro317)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with Cy3.

Epiphycan (EPYC) Polyclonal Antibody (Human), FITC

4-PAJ227Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (His110~Pro317)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with FITC.

Epiphycan (EPYC) Polyclonal Antibody (Human), HRP

4-PAJ227Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (His110~Pro317)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with HRP.

Epiphycan (EPYC) Polyclonal Antibody (Human), PE

4-PAJ227Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (His110~Pro317)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with PE.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat)

4-PAJ227Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (Cys130~Ile322)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC)

Epiphycan (EPYC) Polyclonal Antibody (Human), APC-Cy7

4-PAJ227Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (His110~Pro317)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with APC-Cy7.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), APC

4-PAJ227Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (Cys130~Ile322)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with APC.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), Biotinylated

4-PAJ227Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (Cys130~Ile322)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with Biotin.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), Cy3

4-PAJ227Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (Cys130~Ile322)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with Cy3.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), FITC

4-PAJ227Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (Cys130~Ile322)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with FITC.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), HRP

4-PAJ227Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (Cys130~Ile322)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with HRP.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), PE

4-PAJ227Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (Cys130~Ile322)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with PE.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), APC-Cy7

4-PAJ227Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (Cys130~Ile322)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with APC-Cy7.

EPYC ELISA KIT|Human

EF006788 96 Tests
EUR 689

EPYC siRNA

20-abx915572
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EPYC siRNA

20-abx915573
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human EPYC shRNA Plasmid

20-abx951282
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EPYC Recombinant Protein (Human)

RP010831 100 ug Ask for price

EPYC cloning plasmid

CSB-CL007757HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 969
  • Sequence: atgaagacattagcaggacttgttctgggacttgtcatctttgatgctgctgtgactgccccaactctagagtccatcaactatgactcagaaacctatgatgccaccttagaagacctggataatttgtacaactatgaaaacatacctgttggtaaagttgagattgaaatagc
  • Show more
Description: A cloning plasmid for the EPYC gene.

EPYC Polyclonal Antibody

ES11217-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against EPYC from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

EPYC Polyclonal Antibody

ES11217-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against EPYC from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

EPYC Polyclonal Antibody

ABP58493-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of EPYC from Human, Mouse. This EPYC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220

EPYC Polyclonal Antibody

ABP58493-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of EPYC from Human, Mouse. This EPYC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220

EPYC Polyclonal Antibody

ABP58493-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of EPYC from Human, Mouse. This EPYC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220

Anti-EPYC antibody

STJ192375 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to EPYC

Anti-EPYC (2G6)

YF-MA20319 100 ug
EUR 363
Description: Mouse monoclonal to EPYC

EPYC ORF Vector (Human) (pORF)

ORF003611 1.0 ug DNA
EUR 95

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Mouse EPYC shRNA Plasmid

20-abx970068
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EPYC Recombinant Protein (Rat)

RP199832 100 ug Ask for price

EPYC Recombinant Protein (Mouse)

RP132080 100 ug Ask for price

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

EPYC sgRNA CRISPR Lentivector set (Human)

K0689901 3 x 1.0 ug
EUR 339

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Polyclonal EPYC Antibody - middle region

APR15856G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EPYC - middle region. This antibody is tested and proven to work in the following applications:

Epyc ORF Vector (Rat) (pORF)

ORF066612 1.0 ug DNA
EUR 506

Epyc ORF Vector (Mouse) (pORF)

ORF044028 1.0 ug DNA
EUR 506

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

EPYC sgRNA CRISPR Lentivector (Human) (Target 1)

K0689902 1.0 ug DNA
EUR 154

EPYC sgRNA CRISPR Lentivector (Human) (Target 2)

K0689903 1.0 ug DNA
EUR 154

EPYC sgRNA CRISPR Lentivector (Human) (Target 3)

K0689904 1.0 ug DNA
EUR 154

EPYC Protein Vector (Human) (pPB-C-His)

PV014441 500 ng
EUR 329

EPYC Protein Vector (Human) (pPB-N-His)

PV014442 500 ng
EUR 329

EPYC Protein Vector (Human) (pPM-C-HA)

PV014443 500 ng
EUR 329

EPYC Protein Vector (Human) (pPM-C-His)

PV014444 500 ng
EUR 329

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Epyc sgRNA CRISPR Lentivector set (Mouse)

K3405101 3 x 1.0 ug
EUR 339

Epyc sgRNA CRISPR Lentivector set (Rat)

K6018501 3 x 1.0 ug
EUR 339

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

Epyc sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3405102 1.0 ug DNA
EUR 154

Epyc sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3405103 1.0 ug DNA
EUR 154

Epyc sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3405104 1.0 ug DNA
EUR 154

Epyc sgRNA CRISPR Lentivector (Rat) (Target 1)

K6018502 1.0 ug DNA
EUR 154

Epyc sgRNA CRISPR Lentivector (Rat) (Target 2)

K6018503 1.0 ug DNA
EUR 154

Epyc sgRNA CRISPR Lentivector (Rat) (Target 3)

K6018504 1.0 ug DNA
EUR 154

EPYC Protein Vector (Mouse) (pPB-C-His)

PV176110 500 ng
EUR 603

EPYC Protein Vector (Mouse) (pPB-N-His)

PV176111 500 ng
EUR 603

EPYC Protein Vector (Mouse) (pPM-C-HA)

PV176112 500 ng
EUR 603

EPYC Protein Vector (Mouse) (pPM-C-His)

PV176113 500 ng
EUR 603

EPYC Protein Vector (Rat) (pPB-C-His)

PV266446 500 ng
EUR 603

EPYC Protein Vector (Rat) (pPB-N-His)

PV266447 500 ng
EUR 603

EPYC Protein Vector (Rat) (pPM-C-HA)

PV266448 500 ng
EUR 603

EPYC Protein Vector (Rat) (pPM-C-His)

PV266449 500 ng
EUR 603

Epyc 3'UTR Luciferase Stable Cell Line

TU204058 1.0 ml Ask for price

Epyc 3'UTR GFP Stable Cell Line

TU155902 1.0 ml Ask for price

EPYC 3'UTR Luciferase Stable Cell Line

TU006989 1.0 ml
EUR 1394

Epyc 3'UTR Luciferase Stable Cell Line

TU105902 1.0 ml Ask for price

EPYC 3'UTR GFP Stable Cell Line

TU056989 1.0 ml
EUR 1394

Epyc 3'UTR GFP Stable Cell Line

TU254058 1.0 ml Ask for price

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit

CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

EPYC sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0689905 3 x 1.0 ug
EUR 376

EPYC sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0689906 1.0 ug DNA
EUR 167

EPYC sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0689907 1.0 ug DNA
EUR 167

EPYC sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0689908 1.0 ug DNA
EUR 167

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)

CASCL9-100A-KIT 1 Kit
EUR 1132
  • Category: Cas9

Epyc sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3405105 3 x 1.0 ug
EUR 376

Epyc sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6018505 3 x 1.0 ug
EUR 376

Epyc sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3405106 1.0 ug DNA
EUR 167

Epyc sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3405107 1.0 ug DNA
EUR 167

Epyc sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3405108 1.0 ug DNA
EUR 167

Epyc sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6018506 1.0 ug DNA
EUR 167

Epyc sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6018507 1.0 ug DNA
EUR 167

Epyc sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6018508 1.0 ug DNA
EUR 167

AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS

AP-STR-KIT-P 1/pk
EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Kit ELISA Kit

ELA-E0121h 96 Tests
EUR 824

Human KIT/SCFR ELISA kit

LF-EK50791 1×96T
EUR 648

Human Biopterin ELISA Kit

CELI-66011h 96 Tests
EUR 824

Human lipopolysaccharides ELISA Kit

CELI-66031h 96 Tests
EUR 824

Human Microlbumin ELISA Kit

abx517025-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Trypsin ELISA kit

E01T0139-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Trypsin ELISA kit

E01T0139-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Trypsin ELISA kit

E01T0139-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tryptophane ELISA kit

E01T0140-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tryptophane in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human EPYC(Epiphycan) ELISA Kit