Human EPYC(Epiphycan) ELISA Kit

Human EPYC(Epiphycan) ELISA Kit

Human Epiphycan (EPYC) ELISA Kit
RDR-EPYC-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Epiphycan (EPYC) ELISA Kit
RDR-EPYC-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Epiphycan (EPYC) ELISA Kit
RD-EPYC-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Epiphycan (EPYC) ELISA Kit
RD-EPYC-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Epiphycan (EPYC)ELISA Kit
201-12-2676	SunredBio	96 tests	EUR 440
This Epiphycan ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Epiphycan (EPYC) ELISA Kit
20-abx151434	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Epiphycan (EPYC) ELISA Kit
abx252401-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human EPYC(Epiphycan) ELISA Kit
EH3009	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: Q99645 Alias: EPYC/PG-Lb/SLRR3B/Dermatan sulfate proteoglycan 3dermatan sulphate proteoglycan 3/DSPG3proteoglycan-lb/epiphycan/PGLB/Pg-Lb/PG-Lb/Proteoglycan-Lb/SLRR3Bepiphycan proteoglycan/Small chondroitin Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Epiphycan, EPYC ELISA KIT
ELI-47275h	Lifescience Market	96 Tests	EUR 824

Human Epiphycan(EPYC)ELISA Kit
QY-E03113	Qayee Biotechnology	96T	EUR 361

Human Epiphycan (EPYC) ELISA Kit
SEJ227Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Epiphycan (EPYC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Epiphycan (EPYC) in Tissue homogenates and other biological fluids.

Human Epiphycan (EPYC) ELISA Kit
SEJ227Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Epiphycan (EPYC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Epiphycan (EPYC) in Tissue homogenates and other biological fluids.

Human Epiphycan (EPYC) ELISA Kit
SEJ227Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Epiphycan (EPYC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Epiphycan (EPYC) in Tissue homogenates and other biological fluids.

Human Epiphycan (EPYC) ELISA Kit
SEJ227Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Epiphycan (EPYC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Epiphycan (EPYC) in Tissue homogenates and other biological fluids.

Human Epiphycan (EPYC) ELISA Kit
4-SEJ227Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Epiphycan elisa. Alternative names of the recognized antigen: DSPG3 Pg-Lb SLRR3B Dermatan Sulphate Proteoglycan 3 Dermatan Sulfate Proteoglycan 3 Proteoglycan-Lb Small chondroitin/dermatan sulfate proteoglycan
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Epiphycan (EPYC) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Bovine Epiphycan, EPYC ELISA KIT
ELI-26891b	Lifescience Market	96 Tests	EUR 928

Chicken Epiphycan (EPYC) ELISA Kit
abx354637-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Epiphycan (EPYC) ELISA Kit
abx354912-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Epiphycan (EPYC) ELISA Kit
abx355061-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Epiphycan (EPYC) ELISA Kit
abx355328-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Epiphycan, Epyc ELISA KIT
ELI-32781m	Lifescience Market	96 Tests	EUR 865

Chicken Epiphycan, EPYC ELISA KIT
ELI-47715c	Lifescience Market	96 Tests	EUR 928

Epiphycan (EPYC) Antibody
20-abx100319	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Epiphycan (EPYC) Antibody
20-abx129601	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Epiphycan (EPYC) Antibody
20-abx172275	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Epiphycan (EPYC)
4-RPJ227Hu01	Cloud-Clone	EUR 440.48 EUR 221.00 EUR 1376.80 EUR 525.60 EUR 951.20 EUR 358.00 EUR 3292.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q99645 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 28.1kDa Isoelectric Point: Inquire
Description: Recombinant Human Epiphycan expressed in: E.coli

Recombinant Epiphycan (EPYC)
4-RPJ227Mu01	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P70186 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 26.3kDa Isoelectric Point: 6.9
Description: Recombinant Mouse Epiphycan expressed in: E.coli

ELISA kit for Human EPYC (Epiphycan)
E-EL-H0370	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's EPYC ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human EPYC. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human EPYC (Epiphycan) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human EPYC (Epiphycan)
ELK3102	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Epiphycan (EPYC). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Epiphycan (EPYC). Show more
Description: A sandwich ELISA kit for detection of Epiphycan from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Epiphycan (EPYC) CLIA Kit
abx195548-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Epiphycan (EPYC) CLIA Kit
20-abx495642	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Epiphycan (EPYC) Protein
20-abx066448	Abbexa	EUR 620.00 EUR 272.00 EUR 1859.00 EUR 732.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Guinea pig Epiphycan (EPYC) ELISA Kit
abx354871-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Epiphycan (EPYC) Protein
20-abx167271	Abbexa	EUR 676.00 EUR 286.00 EUR 2082.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

CLIA kit for Human EPYC (Epiphycan)
E-CL-H0301	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's EPYC CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human EPYC . Standards or samples are added to the micro CLIA plate wells and combined with the Show more
Description: A sandwich CLIA kit for quantitative measurement of Human EPYC (Epiphycan) in samples from Serum, Plasma, Cell supernatant

Epiphycan (EPYC) Polyclonal Antibody (Human)
4-PAJ227Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EPYC (His110~Pro317) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC)

Epiphycan (EPYC) Polyclonal Antibody (Human), APC
4-PAJ227Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EPYC (His110~Pro317) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with APC.

Epiphycan (EPYC) Polyclonal Antibody (Human), Biotinylated
4-PAJ227Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EPYC (His110~Pro317) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with Biotin.

Epiphycan (EPYC) Polyclonal Antibody (Human), Cy3
4-PAJ227Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EPYC (His110~Pro317) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with Cy3.

Epiphycan (EPYC) Polyclonal Antibody (Human), FITC
4-PAJ227Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EPYC (His110~Pro317) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with FITC.

Epiphycan (EPYC) Polyclonal Antibody (Human), HRP
4-PAJ227Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EPYC (His110~Pro317) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with HRP.

Epiphycan (EPYC) Polyclonal Antibody (Human), PE
4-PAJ227Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EPYC (His110~Pro317) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with PE.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat)
4-PAJ227Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EPYC (Cys130~Ile322) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC)

Epiphycan (EPYC) Polyclonal Antibody (Human), APC-Cy7
4-PAJ227Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EPYC (His110~Pro317) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with APC-Cy7.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), APC
4-PAJ227Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EPYC (Cys130~Ile322) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with APC.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), Biotinylated
4-PAJ227Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EPYC (Cys130~Ile322) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with Biotin.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), Cy3
4-PAJ227Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EPYC (Cys130~Ile322) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with Cy3.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), FITC
4-PAJ227Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EPYC (Cys130~Ile322) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with FITC.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), HRP
4-PAJ227Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EPYC (Cys130~Ile322) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with HRP.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), PE
4-PAJ227Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EPYC (Cys130~Ile322) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with PE.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), APC-Cy7
4-PAJ227Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EPYC (Cys130~Ile322) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with APC-Cy7.

EPYC ELISA KIT|Human
EF006788	Lifescience Market	96 Tests	EUR 689

EPYC ELISA Kit (Human) (OKCD09160)
OKCD09160	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Dermatan sulfate proteoglycan 3 is a member of the small leucine-rich repeat proteoglycan family. This gene is composed of seven exons. It regulates fibrillogenesis by interacting with collagen fibrils and other extracellular matrix proteins.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL

EPYC ELISA Kit (Human) (OKDD00254)
OKDD00254	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Dermatan sulfate proteoglycan 3 is a member of the small leucine-rich repeat proteoglycan family. This gene is composed of seven exons. It regulates fibrillogenesis by interacting with collagen fibrils and other extracellular matrix proteins.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.056 ng/mL

EPYC siRNA
20-abx915572	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EPYC siRNA
20-abx915573	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human EPYC shRNA Plasmid
20-abx951282	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

EPYC Recombinant Protein (Human)
RP010831	ABM	100 ug	Ask for price

EPYC Polyclonal Antibody
ABP58493-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220 Applications tips:
Description: A polyclonal antibody for detection of EPYC from Human, Mouse. This EPYC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220

EPYC Polyclonal Antibody
ABP58493-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220 Applications tips:
Description: A polyclonal antibody for detection of EPYC from Human, Mouse. This EPYC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220

EPYC Polyclonal Antibody
ABP58493-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220 Applications tips:
Description: A polyclonal antibody for detection of EPYC from Human, Mouse. This EPYC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220

EPYC cloning plasmid
CSB-CL007757HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 969 Sequence: atgaagacattagcaggacttgttctgggacttgtcatctttgatgctgctgtgactgccccaactctagagtccatcaactatgactcagaaacctatgatgccaccttagaagacctggataatttgtacaactatgaaaacatacctgttggtaaagttgagattgaaatagc Show more
Description: A cloning plasmid for the EPYC gene.

EPYC Polyclonal Antibody
ES11217-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against EPYC from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

EPYC Polyclonal Antibody
ES11217-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against EPYC from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-EPYC antibody
STJ192375	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to EPYC

Anti-EPYC (2G6)
YF-MA20319	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to EPYC

EPYC ORF Vector (Human) (pORF)
ORF003611	ABM	1.0 ug DNA	EUR 95

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Mouse EPYC shRNA Plasmid
20-abx970068	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

EPYC Recombinant Protein (Rat)
RP199832	ABM	100 ug	Ask for price

EPYC Recombinant Protein (Mouse)
RP132080	ABM	100 ug	Ask for price

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

EPYC sgRNA CRISPR Lentivector set (Human)
K0689901	ABM	3 x 1.0 ug	EUR 339

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Polyclonal EPYC Antibody - middle region
APR15856G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EPYC - middle region. This antibody is tested and proven to work in the following applications:

Epyc ORF Vector (Rat) (pORF)
ORF066612	ABM	1.0 ug DNA	EUR 506

Epyc ORF Vector (Mouse) (pORF)
ORF044028	ABM	1.0 ug DNA	EUR 506

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

EPYC sgRNA CRISPR Lentivector (Human) (Target 1)
K0689902	ABM	1.0 ug DNA	EUR 154

EPYC sgRNA CRISPR Lentivector (Human) (Target 2)
K0689903	ABM	1.0 ug DNA	EUR 154

EPYC sgRNA CRISPR Lentivector (Human) (Target 3)
K0689904	ABM	1.0 ug DNA	EUR 154

EPYC Protein Vector (Human) (pPB-C-His)
PV014441	ABM	500 ng	EUR 329

EPYC Protein Vector (Human) (pPB-N-His)
PV014442	ABM	500 ng	EUR 329

EPYC Protein Vector (Human) (pPM-C-HA)
PV014443	ABM	500 ng	EUR 329

EPYC Protein Vector (Human) (pPM-C-His)
PV014444	ABM	500 ng	EUR 329

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Epyc sgRNA CRISPR Lentivector set (Rat)
K6018501	ABM	3 x 1.0 ug	EUR 339

Epyc sgRNA CRISPR Lentivector set (Mouse)
K3405101	ABM	3 x 1.0 ug	EUR 339

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

vWF Acty. Kit
ABP-ACT-KIT	Abpcorp	12 x 8 microwells	EUR 428

vWF Ant. Kit
ABP-TOT-KIT	Abpcorp	12 x 8 microwells	EUR 394

Epyc sgRNA CRISPR Lentivector (Rat) (Target 1)
K6018502	ABM	1.0 ug DNA	EUR 154

Epyc sgRNA CRISPR Lentivector (Rat) (Target 2)
K6018503	ABM	1.0 ug DNA	EUR 154

Epyc sgRNA CRISPR Lentivector (Rat) (Target 3)
K6018504	ABM	1.0 ug DNA	EUR 154

Epyc sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3405102	ABM	1.0 ug DNA	EUR 154

Epyc sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3405103	ABM	1.0 ug DNA	EUR 154

Epyc sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3405104	ABM	1.0 ug DNA	EUR 154

EPYC Protein Vector (Mouse) (pPB-C-His)
PV176110	ABM	500 ng	EUR 603

EPYC Protein Vector (Mouse) (pPB-N-His)
PV176111	ABM	500 ng	EUR 603

EPYC Protein Vector (Mouse) (pPM-C-HA)
PV176112	ABM	500 ng	EUR 603

EPYC Protein Vector (Mouse) (pPM-C-His)
PV176113	ABM	500 ng	EUR 603

EPYC Protein Vector (Rat) (pPB-C-His)
PV266446	ABM	500 ng	EUR 603

EPYC Protein Vector (Rat) (pPB-N-His)
PV266447	ABM	500 ng	EUR 603

EPYC Protein Vector (Rat) (pPM-C-HA)
PV266448	ABM	500 ng	EUR 603

EPYC Protein Vector (Rat) (pPM-C-His)
PV266449	ABM	500 ng	EUR 603

Epyc 3'UTR GFP Stable Cell Line
TU155902	ABM	1.0 ml	Ask for price

Epyc 3'UTR Luciferase Stable Cell Line
TU105902	ABM	1.0 ml	Ask for price

Epyc 3'UTR Luciferase Stable Cell Line
TU204058	ABM	1.0 ml	Ask for price

Epyc 3'UTR GFP Stable Cell Line
TU254058	ABM	1.0 ml	Ask for price

EPYC 3'UTR GFP Stable Cell Line
TU056989	ABM	1.0 ml	EUR 1394

EPYC 3'UTR Luciferase Stable Cell Line
TU006989	ABM	1.0 ml	EUR 1394

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT	SBI	1 kit	EUR 2152
Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT	SBI	10 rxn	EUR 445
Category: Cas9

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

EPYC sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0689905	ABM	3 x 1.0 ug	EUR 376

EPYC sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0689906	ABM	1.0 ug DNA	EUR 167

EPYC sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0689907	ABM	1.0 ug DNA	EUR 167

EPYC sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0689908	ABM	1.0 ug DNA	EUR 167

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)
CASCL9-100A-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Epyc sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6018505	ABM	3 x 1.0 ug	EUR 376

Epyc sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3405105	ABM	3 x 1.0 ug	EUR 376

Epyc sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6018506	ABM	1.0 ug DNA	EUR 167

Epyc sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6018507	ABM	1.0 ug DNA	EUR 167

Epyc sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6018508	ABM	1.0 ug DNA	EUR 167

Epyc sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3405106	ABM	1.0 ug DNA	EUR 167

Epyc sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3405107	ABM	1.0 ug DNA	EUR 167

Epyc sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3405108	ABM	1.0 ug DNA	EUR 167

AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS
AP-STR-KIT-P	CORNING	1/pk	EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Kit ELISA Kit
ELA-E0121h	Lifescience Market	96 Tests	EUR 824

Human KIT/SCFR ELISA kit
LF-EK50791	Abfrontier	1×96T	EUR 648

KIT ELISA Kit (Human) (OKAN04574)
OKAN04574	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL

KIT ELISA Kit (Human) (OKCD06003)
OKCD06003	Aviva Systems Biology	96 Wells	EUR 648
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.61ng/mL

Human Pentosidine ELISA Kit
201-12-0005	SunredBio	96 tests	EUR 440
This Pentosidine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Amylin ELISA Kit
201-12-0017	SunredBio	96 tests	EUR 440
This Amylin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human visfatin ELISA Kit
201-12-0026	SunredBio	96 tests	EUR 440
This visfatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human EPYC(Epiphycan) ELISA Kit