Human DCD(Dermcidin) ELISA Kit

Human DCD(Dermcidin) ELISA Kit

Human Dermcidin (DCD) ELISA Kit

RDR-DCD-Hu-96Tests 96 Tests
EUR 756

Human Dermcidin (DCD) ELISA Kit

RD-DCD-Hu-48Tests 48 Tests
EUR 521

Human Dermcidin (DCD) ELISA Kit

RD-DCD-Hu-96Tests 96 Tests
EUR 723

Rat Dermcidin (DCD) ELISA Kit

DLR-DCD-Ra-48T 48T
EUR 549
  • Should the Rat Dermcidin (DCD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Dermcidin (DCD) in samples from tissue homogenates or other biological fluids.

Rat Dermcidin (DCD) ELISA Kit

DLR-DCD-Ra-96T 96T
EUR 718
  • Should the Rat Dermcidin (DCD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Dermcidin (DCD) in samples from tissue homogenates or other biological fluids.

Rat Dermcidin (DCD) ELISA Kit

RDR-DCD-Ra-48Tests 48 Tests
EUR 583

Rat Dermcidin (DCD) ELISA Kit

RDR-DCD-Ra-96Tests 96 Tests
EUR 811

Rat Dermcidin (DCD) ELISA Kit

RD-DCD-Ra-48Tests 48 Tests
EUR 557

Rat Dermcidin (DCD) ELISA Kit

RD-DCD-Ra-96Tests 96 Tests
EUR 775

Human Dermcidin, DCD ELISA KIT

ELI-28148h 96 Tests
EUR 824

Human Dermcidin (DCD) ELISA Kit

20-abx151294
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Dermcidin (DCD) ELISA Kit

abx257296-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human Dermcidin (DCD) ELISA Kit

SEC896Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Dermcidin (DCD) ELISA Kit

SEC896Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Dermcidin (DCD) ELISA Kit

SEC896Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Dermcidin (DCD) ELISA Kit

SEC896Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Dermcidin (DCD) ELISA Kit

4-SEC896Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dermcidin elisa. Alternative names of the recognized antigen: HCAP
  • AIDD
  • DCD1
  • DSEP
  • PIF
  • Proteolysis Inducing Factor
  • Preproteolysin
  • Diffusible Survival/Evasion Peptide
  • Survival Promoting Peptide
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dermcidin (DCD) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Dermcidin ELISA Kit (DCD)

RK01249 96 Tests
EUR 521

Human Dermcidin (DCD)

1-CSB-YP006537HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 11.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Dermcidin(DCD) expressed in Yeast

Human Dermcidin (DCD)

1-CSB-EP006537HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 36.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Dermcidin(DCD) expressed in E.coli

Human Dermcidin (DCD)

1-CSB-EP006537HUa6
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 23.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Dermcidin(DCD) expressed in E.coli

Rat Dermcidin (DCD) ELISA Kit

20-abx155435
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Dermcidin (DCD) ELISA Kit

SEC896Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Dermcidin (DCD) ELISA Kit

SEC896Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Dermcidin (DCD) ELISA Kit

SEC896Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Dermcidin (DCD) ELISA Kit

SEC896Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Dermcidin (DCD) ELISA Kit

4-SEC896Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dermcidin elisa. Alternative names of the recognized antigen: HCAP
  • AIDD
  • DCD1
  • DSEP
  • PIF
  • Proteolysis Inducing Factor
  • Preproteolysin
  • Diffusible Survival/Evasion Peptide
  • Survival Promoting Peptide
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Dermcidin (DCD) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Dermcidin ELISA Kit (DCD)

RK03614 96 Tests
EUR 521

ELISA kit for Human DCD (Dermcidin)

ELK2908 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dermcidin (DCD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dermcidin (DCD). N
  • Show more
Description: A sandwich ELISA kit for detection of Dermcidin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Dermcidin (DCD) Antibody

20-abx109721
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dermcidin (DCD) Antibody

20-abx141389
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dermcidin (DCD) Antibody

20-abx100245
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dermcidin (DCD) Antibody

abx032955-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dermcidin (DCD) Antibody

abx032955-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dermcidin (DCD) Antibody

20-abx005487
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dermcidin (DCD) Antibody

20-abx172090
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dermcidin (DCD) Antibody

20-abx172091
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dermcidin (DCD) Antibody

20-abx176148
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dermcidin (DCD) Antibody

abx232263-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Recombinant Dermcidin (DCD)

4-RPC896Hu01
  • EUR 504.99
  • EUR 238.00
  • EUR 1618.72
  • EUR 606.24
  • EUR 1112.48
  • EUR 401.00
  • EUR 3896.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P81605
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 11.0kDa
  • Isoelectric Point: 6.2
Description: Recombinant Human Dermcidin expressed in: E.coli

Human Dermcidin (DCD) CLIA Kit

20-abx493964
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Dermcidin (DCD) Protein

20-abx066308
  • EUR 704.00
  • EUR 286.00
  • EUR 2179.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

ELISA kit for Rat DCD (Dermcidin)

ELK6013 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dermcidin (DCD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dermcidin (DCD). N
  • Show more
Description: A sandwich ELISA kit for detection of Dermcidin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Dermcidin (DCD) CLIA Kit

20-abx493965
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Dermcidin (DCD) Protein

20-abx653162
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Dermcidin (DCD) Antibody (HRP)

20-abx108177
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dermcidin (DCD) Antibody (Biotin)

20-abx105339
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dermcidin (DCD) Antibody (FITC)

20-abx106758
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dermcidin (DCD) Antibody (Biotin)

20-abx272301
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Dermcidin (DCD) Polyclonal Antibody (Human)

4-PAC896Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCD (Cys18~Leu110)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD)

Dermcidin (DCD) Polyclonal Antibody (Human), APC

4-PAC896Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCD (Cys18~Leu110)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with APC.

Dermcidin (DCD) Polyclonal Antibody (Human), Biotinylated

4-PAC896Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCD (Cys18~Leu110)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with Biotin.

Dermcidin (DCD) Polyclonal Antibody (Human), Cy3

4-PAC896Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCD (Cys18~Leu110)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with Cy3.

Dermcidin (DCD) Polyclonal Antibody (Human), FITC

4-PAC896Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCD (Cys18~Leu110)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with FITC.

Dermcidin (DCD) Polyclonal Antibody (Human), HRP

4-PAC896Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCD (Cys18~Leu110)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with HRP.

Dermcidin (DCD) Polyclonal Antibody (Human), PE

4-PAC896Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCD (Cys18~Leu110)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with PE.

Human PIF/DCD(Proteolysis Inducing Factor/Dermcidin) ELISA Kit

EH4251 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P81605
  • Alias: AIDD, DCD-1, DSEP, HCAP, MGC71930, PIF, diffusible survival/evasion peptide|preproteolysin|proteolysis inducing factor|survival promoting peptide
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Proteolysis Inducing Factor/Dermcidin(PIF/DCD)ELISA Kit

CSB-E13626h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD) in samples from serum, plasma, cell culture supernates, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Proteolysis Inducing Factor/Dermcidin(PIF/DCD)ELISA Kit

1-CSB-E13626h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Proteolysis Inducing Factor/Dermcidin(PIF/DCD) in samples from serum, plasma, cell culture supernates, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Dermcidin (DCD) Polyclonal Antibody (Human), APC-Cy7

4-PAC896Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCD (Cys18~Leu110)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with APC-Cy7.

ELISA kit for Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD)

KTE62411-48T 48T
EUR 354
  • Dermcidin is a secreted protein that is subsequently processed into mature peptides of distinct biological activities. The C-terminal peptide is constitutively expressed in sweat and has antibacterial and antifungal activities. The N-terminal peptide
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD)

KTE62411-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Dermcidin is a secreted protein that is subsequently processed into mature peptides of distinct biological activities. The C-terminal peptide is constitutively expressed in sweat and has antibacterial and antifungal activities. The N-terminal peptide
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD)

KTE62411-96T 96T
EUR 572
  • Dermcidin is a secreted protein that is subsequently processed into mature peptides of distinct biological activities. The C-terminal peptide is constitutively expressed in sweat and has antibacterial and antifungal activities. The N-terminal peptide
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-100ug

QP5914-ec-100ug 100ug
EUR 408

Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-10ug

QP5914-ec-10ug 10ug
EUR 200

Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-1mg

QP5914-ec-1mg 1mg
EUR 1632

Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-200ug

QP5914-ec-200ug 200ug
EUR 634

Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-500ug

QP5914-ec-500ug 500ug
EUR 1060

Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-50ug

QP5914-ec-50ug 50ug
EUR 263

Recombinant Human Dermcidin/ DCD Protein, His, Yeast-100ug

QP5914-ye-100ug 100ug
EUR 480

Recombinant Human Dermcidin/ DCD Protein, His, Yeast-10ug

QP5914-ye-10ug 10ug
EUR 236

Recombinant Human Dermcidin/ DCD Protein, His, Yeast-1mg

QP5914-ye-1mg 1mg
EUR 1885

Recombinant Human Dermcidin/ DCD Protein, His, Yeast-200ug

QP5914-ye-200ug 200ug
EUR 744

Recombinant Human Dermcidin/ DCD Protein, His, Yeast-500ug

QP5914-ye-500ug 500ug
EUR 1206

Recombinant Human Dermcidin/ DCD Protein, His, Yeast-50ug

QP5914-ye-50ug 50ug
EUR 299

Dermcidin

D077-5MG 5mg
EUR 349

PIF/DCD ELISA KIT|Human

EF007421 96 Tests
EUR 689

Dermcidin-1L (human)

H-7316.0500 0.5mg
EUR 177
Description: Sum Formula: C210H359N57O71; CAS# [478898-18-9] net

Dermcidin-1L (human)

H-7316.1000 1.0mg
EUR 294
Description: Sum Formula: C210H359N57O71; CAS# [478898-18-9] net

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

DCD siRNA

20-abx913661
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DCD Antibody

47246-100ul 100ul
EUR 252

DCD Antibody

1-CSB-PA006537DA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DCD. Recognizes DCD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

Human DCD shRNA Plasmid

20-abx964554
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DCD Recombinant Protein (Human)

RP008806 100 ug Ask for price

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

DCD Conjugated Antibody

C47246 100ul
EUR 397

DCD cloning plasmid

CSB-CL006537HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 333
  • Sequence: atgaggttcatgactctcctcttcctgacagctctggcaggagccctggtctgtgcctatgatccagaggccgcctctgccccaggatcggggaacccttgccatgaagcatcagcagctcaaaaggaaaatgcaggtgaagacccagggttagccagacaggcaccaaagccaag
  • Show more
Description: A cloning plasmid for the DCD gene.

anti- DCD antibody

FNab02263 100µg
EUR 585
  • Immunogen: dermcidin
  • Uniprot ID: P81605
  • Gene ID: 117159
  • Research Area: Immunology
Description: Antibody raised against DCD

DCD Polyclonal Antibody

A53288 100 µg
EUR 570.55
Description: Ask the seller for details

DCD Rabbit pAb

A7280-100ul 100 ul
EUR 308

DCD Rabbit pAb

A7280-200ul 200 ul
EUR 459

DCD Rabbit pAb

A7280-20ul 20 ul
EUR 183

DCD Rabbit pAb

A7280-50ul 50 ul
EUR 223

Anti-DCD antibody

PAab02263 100 ug
EUR 412

Anti-DCD antibody

STJ29419 100 µl
EUR 277
Description: This antimicrobial gene encodes a secreted protein that is subsequently processed into mature peptides of distinct biological activities. The C-terminal peptide is constitutively expressed in sweat and has antibacterial and antifungal activities. The N-terminal peptide, also known as diffusible survival evasion peptide, promotes neural cell survival under conditions of severe oxidative stress. A glycosylated form of the N-terminal peptide may be associated with cachexia (muscle wasting) in cancer patients. Alternative splicing results in multiple transcript variants encoding different isoforms.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

DCD ORF Vector (Human) (pORF)

ORF002936 1.0 ug DNA
EUR 95

Human DCD(Dermcidin) ELISA Kit