Human DCD(Dermcidin) ELISA Kit
Human Dermcidin (DCD) ELISA Kit |
RDR-DCD-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Dermcidin (DCD) ELISA Kit |
RD-DCD-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Dermcidin (DCD) ELISA Kit |
RD-DCD-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Rat Dermcidin (DCD) ELISA Kit |
DLR-DCD-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Dermcidin (DCD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Dermcidin (DCD) in samples from tissue homogenates or other biological fluids. |
Rat Dermcidin (DCD) ELISA Kit |
DLR-DCD-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Dermcidin (DCD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Dermcidin (DCD) in samples from tissue homogenates or other biological fluids. |
Rat Dermcidin (DCD) ELISA Kit |
RDR-DCD-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Dermcidin (DCD) ELISA Kit |
RDR-DCD-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Rat Dermcidin (DCD) ELISA Kit |
RD-DCD-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Dermcidin (DCD) ELISA Kit |
RD-DCD-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Human Dermcidin (DCD) |
1-CSB-YP006537HU |
Cusabio |
-
EUR 430.00
-
EUR 234.00
-
EUR 1508.00
-
EUR 642.00
-
EUR 1009.00
-
EUR 291.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 11.3 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Dermcidin(DCD) expressed in Yeast |
Human Dermcidin (DCD) |
1-CSB-EP006537HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 36.3 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Dermcidin(DCD) expressed in E.coli |
Human Dermcidin (DCD) |
1-CSB-EP006537HUa6 |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 23.3 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Dermcidin(DCD) expressed in E.coli |
Human Dermcidin (DCD) ELISA Kit |
20-abx151294 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Dermcidin (DCD) ELISA Kit |
abx257296-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 5-12 working days.
|
Human Dermcidin (DCD) ELISA Kit |
SEC896Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Dermcidin (DCD) ELISA Kit |
SEC896Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Dermcidin (DCD) ELISA Kit |
SEC896Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Dermcidin (DCD) ELISA Kit |
SEC896Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Dermcidin (DCD) ELISA Kit |
4-SEC896Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Dermcidin elisa. Alternative names of the recognized antigen: HCAP
- AIDD
- DCD1
- DSEP
- PIF
- Proteolysis Inducing Factor
- Preproteolysin
- Diffusible Survival/Evasion Peptide
- Survival Promoting Peptide
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dermcidin (DCD) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Dermcidin ELISA Kit (DCD) |
RK01249 |
Abclonal |
96 Tests |
EUR 521 |
Rat Dermcidin (DCD) ELISA Kit |
20-abx155435 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Dermcidin (DCD) ELISA Kit |
SEC896Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Dermcidin (DCD) ELISA Kit |
SEC896Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Dermcidin (DCD) ELISA Kit |
SEC896Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Dermcidin (DCD) ELISA Kit |
SEC896Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Dermcidin (DCD) ELISA Kit |
4-SEC896Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Dermcidin elisa. Alternative names of the recognized antigen: HCAP
- AIDD
- DCD1
- DSEP
- PIF
- Proteolysis Inducing Factor
- Preproteolysin
- Diffusible Survival/Evasion Peptide
- Survival Promoting Peptide
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Dermcidin (DCD) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Dermcidin ELISA Kit (DCD) |
RK03614 |
Abclonal |
96 Tests |
EUR 521 |
Dermcidin (DCD) Antibody |
20-abx109721 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Dermcidin (DCD) Antibody |
20-abx141389 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Dermcidin (DCD) Antibody |
20-abx100245 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Dermcidin (DCD) Antibody |
abx032955-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Dermcidin (DCD) Antibody |
abx032955-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Dermcidin (DCD) Antibody |
20-abx005487 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Dermcidin (DCD) Antibody |
20-abx172090 |
Abbexa |
|
|
|
Dermcidin (DCD) Antibody |
20-abx172091 |
Abbexa |
|
|
|
Dermcidin (DCD) Antibody |
20-abx176148 |
Abbexa |
|
|
|
Dermcidin (DCD) Antibody |
abx232263-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Recombinant Dermcidin (DCD) |
4-RPC896Hu01 |
Cloud-Clone |
-
EUR 504.99
-
EUR 238.00
-
EUR 1618.72
-
EUR 606.24
-
EUR 1112.48
-
EUR 401.00
-
EUR 3896.80
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P81605
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 11.0kDa
- Isoelectric Point: 6.2
|
Description: Recombinant Human Dermcidin expressed in: E.coli |
ELISA kit for Human DCD (Dermcidin) |
ELK2908 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dermcidin (DCD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dermcidin (DCD). N
- Show more
|
Description: A sandwich ELISA kit for detection of Dermcidin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Dermcidin (DCD) CLIA Kit |
20-abx493964 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Dermcidin (DCD) Protein |
20-abx066308 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2179.00
-
EUR 843.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
ELISA kit for Rat DCD (Dermcidin) |
ELK6013 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dermcidin (DCD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dermcidin (DCD). N
- Show more
|
Description: A sandwich ELISA kit for detection of Dermcidin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Rat Dermcidin (DCD) CLIA Kit |
20-abx493965 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Rat Dermcidin (DCD) Protein |
20-abx653162 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Dermcidin (DCD) Antibody (HRP) |
20-abx108177 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Dermcidin (DCD) Antibody (Biotin) |
20-abx105339 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Dermcidin (DCD) Antibody (FITC) |
20-abx106758 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Dermcidin (DCD) Antibody (Biotin) |
20-abx272301 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Dermcidin (DCD) Polyclonal Antibody (Human) |
4-PAC896Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DCD (Cys18~Leu110)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD) |
Dermcidin (DCD) Polyclonal Antibody (Human), APC |
4-PAC896Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DCD (Cys18~Leu110)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with APC. |
Dermcidin (DCD) Polyclonal Antibody (Human), Biotinylated |
4-PAC896Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DCD (Cys18~Leu110)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with Biotin. |
Dermcidin (DCD) Polyclonal Antibody (Human), Cy3 |
4-PAC896Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DCD (Cys18~Leu110)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with Cy3. |
Dermcidin (DCD) Polyclonal Antibody (Human), FITC |
4-PAC896Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DCD (Cys18~Leu110)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with FITC. |
Dermcidin (DCD) Polyclonal Antibody (Human), HRP |
4-PAC896Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DCD (Cys18~Leu110)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with HRP. |
Dermcidin (DCD) Polyclonal Antibody (Human), PE |
4-PAC896Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DCD (Cys18~Leu110)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with PE. |
Human PIF/DCD(Proteolysis Inducing Factor/Dermcidin) ELISA Kit |
EH4251 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.313-20 ng/ml
- Uniprot ID: P81605
- Alias: AIDD, DCD-1, DSEP, HCAP, MGC71930, PIF, diffusible survival/evasion peptide|preproteolysin|proteolysis inducing factor|survival promoting peptide
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Human Proteolysis Inducing Factor/Dermcidin(PIF/DCD)ELISA Kit |
CSB-E13626h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD) in samples from serum, plasma, cell culture supernates, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Proteolysis Inducing Factor/Dermcidin(PIF/DCD)ELISA Kit |
1-CSB-E13626h |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Proteolysis Inducing Factor/Dermcidin(PIF/DCD) in samples from serum, plasma, cell culture supernates, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Dermcidin (DCD) Polyclonal Antibody (Human), APC-Cy7 |
4-PAC896Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DCD (Cys18~Leu110)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with APC-Cy7. |
ELISA kit for Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD) |
KTE62411-48T |
Abbkine |
48T |
EUR 354 |
- Dermcidin is a secreted protein that is subsequently processed into mature peptides of distinct biological activities. The C-terminal peptide is constitutively expressed in sweat and has antibacterial and antifungal activities. The N-terminal peptide
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD) |
KTE62411-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Dermcidin is a secreted protein that is subsequently processed into mature peptides of distinct biological activities. The C-terminal peptide is constitutively expressed in sweat and has antibacterial and antifungal activities. The N-terminal peptide
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD) |
KTE62411-96T |
Abbkine |
96T |
EUR 572 |
- Dermcidin is a secreted protein that is subsequently processed into mature peptides of distinct biological activities. The C-terminal peptide is constitutively expressed in sweat and has antibacterial and antifungal activities. The N-terminal peptide
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-100ug |
QP5914-ec-100ug |
EnQuireBio |
100ug |
EUR 408 |
Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-10ug |
QP5914-ec-10ug |
EnQuireBio |
10ug |
EUR 200 |
Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-1mg |
QP5914-ec-1mg |
EnQuireBio |
1mg |
EUR 1632 |
Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-200ug |
QP5914-ec-200ug |
EnQuireBio |
200ug |
EUR 634 |
Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-500ug |
QP5914-ec-500ug |
EnQuireBio |
500ug |
EUR 1060 |
Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-50ug |
QP5914-ec-50ug |
EnQuireBio |
50ug |
EUR 263 |
Recombinant Human Dermcidin/ DCD Protein, His, Yeast-100ug |
QP5914-ye-100ug |
EnQuireBio |
100ug |
EUR 480 |
Recombinant Human Dermcidin/ DCD Protein, His, Yeast-10ug |
QP5914-ye-10ug |
EnQuireBio |
10ug |
EUR 236 |
Recombinant Human Dermcidin/ DCD Protein, His, Yeast-1mg |
QP5914-ye-1mg |
EnQuireBio |
1mg |
EUR 1885 |
Recombinant Human Dermcidin/ DCD Protein, His, Yeast-200ug |
QP5914-ye-200ug |
EnQuireBio |
200ug |
EUR 744 |
Recombinant Human Dermcidin/ DCD Protein, His, Yeast-500ug |
QP5914-ye-500ug |
EnQuireBio |
500ug |
EUR 1206 |
Recombinant Human Dermcidin/ DCD Protein, His, Yeast-50ug |
QP5914-ye-50ug |
EnQuireBio |
50ug |
EUR 299 |
Dermcidin |
D077-5MG |
TOKU-E |
5mg |
EUR 349 |
DCD ELISA Kit (Human) (OKCD01277) |
OKCD01277 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: DCD-1 displays antimicrobial activity thereby limiting skin infection by potential pathogens in the first few hours after bacterial colonization. Highly effective against E.coli, E.faecalis, S.aureus and C.albicans. Optimal pH and salt concentration resemble the conditions in sweat. Also exhibits proteolytic activity. Survival-promoting peptide promotes survival of neurons and displays phosphatase activity. It may bind IgG. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.31 ng/mL |
DCD ELISA Kit (Human) (OKAN06409) |
OKAN06409 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This antimicrobial gene encodes a secreted protein that is subsequently processed into mature peptides of distinct biological activities. The C-terminal peptide is constitutively expressed in sweat and has antibacterial and antifungal activities. The N-terminal peptide, also known as diffusible survival evasion peptide, promotes neural cell survival under conditions of severe oxidative stress. A glycosylated form of the N-terminal peptide may be associated with cachexia (muscle wasting) in cancer patients. Alternative splicing results in multiple transcript variants encoding different isoforms.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.31 ng/mL |
Dermcidin-1L (human) |
H-7316.0500 |
Bachem |
0.5mg |
EUR 177 |
Description: Sum Formula: C210H359N57O71; CAS# [478898-18-9] net |
Dermcidin-1L (human) |
H-7316.1000 |
Bachem |
1.0mg |
EUR 294 |
Description: Sum Formula: C210H359N57O71; CAS# [478898-18-9] net |
DCD ELISA Kit (Rat) (OKAN06433) |
OKAN06433 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL |
DCD ELISA Kit (Rat) (OKDD00644) |
OKDD00644 |
Aviva Systems Biology |
96 Wells |
EUR 1040 |
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.057 ng/mL |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
DCD siRNA |
20-abx913661 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DCD Antibody |
47246-100ul |
SAB |
100ul |
EUR 252 |
DCD Antibody |
1-CSB-PA006537DA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DCD. Recognizes DCD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500 |
Human DCD shRNA Plasmid |
20-abx964554 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
DCD Recombinant Protein (Human) |
RP008806 |
ABM |
100 ug |
Ask for price |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
DCD Conjugated Antibody |
C47246 |
SAB |
100ul |
EUR 397 |
DCD cloning plasmid |
CSB-CL006537HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 333
- Sequence: atgaggttcatgactctcctcttcctgacagctctggcaggagccctggtctgtgcctatgatccagaggccgcctctgccccaggatcggggaacccttgccatgaagcatcagcagctcaaaaggaaaatgcaggtgaagacccagggttagccagacaggcaccaaagccaag
- Show more
|
Description: A cloning plasmid for the DCD gene. |
anti- DCD antibody |
FNab02263 |
FN Test |
100µg |
EUR 585 |
- Immunogen: dermcidin
- Uniprot ID: P81605
- Gene ID: 117159
- Research Area: Immunology
|
Description: Antibody raised against DCD |
DCD Polyclonal Antibody |
A53288 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
DCD Rabbit pAb |
A7280-100ul |
Abclonal |
100 ul |
EUR 308 |
DCD Rabbit pAb |
A7280-200ul |
Abclonal |
200 ul |
EUR 459 |
DCD Rabbit pAb |
A7280-20ul |
Abclonal |
20 ul |
EUR 183 |
DCD Rabbit pAb |
A7280-50ul |
Abclonal |
50 ul |
EUR 223 |
Human DCD(Dermcidin) ELISA Kit