Human DCD(Dermcidin) ELISA Kit

Human DCD(Dermcidin) ELISA Kit

Human Dermcidin (DCD) ELISA Kit
RDR-DCD-Hu-96Tests 96 Tests
EUR 756

Human Dermcidin (DCD) ELISA Kit
RD-DCD-Hu-48Tests 48 Tests
EUR 521

Human Dermcidin (DCD) ELISA Kit
RD-DCD-Hu-96Tests 96 Tests
EUR 723

Rat Dermcidin (DCD) ELISA Kit
DLR-DCD-Ra-48T 48T
EUR 549
  • Should the Rat Dermcidin (DCD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Dermcidin (DCD) in samples from tissue homogenates or other biological fluids.

Rat Dermcidin (DCD) ELISA Kit
DLR-DCD-Ra-96T 96T
EUR 718
  • Should the Rat Dermcidin (DCD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Dermcidin (DCD) in samples from tissue homogenates or other biological fluids.

Rat Dermcidin (DCD) ELISA Kit
RDR-DCD-Ra-48Tests 48 Tests
EUR 583

Rat Dermcidin (DCD) ELISA Kit
RDR-DCD-Ra-96Tests 96 Tests
EUR 811

Rat Dermcidin (DCD) ELISA Kit
RD-DCD-Ra-48Tests 48 Tests
EUR 557

Rat Dermcidin (DCD) ELISA Kit
RD-DCD-Ra-96Tests 96 Tests
EUR 775

Human Dermcidin (DCD)
1-CSB-YP006537HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 11.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Dermcidin(DCD) expressed in Yeast

Human Dermcidin (DCD)
1-CSB-EP006537HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 36.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Dermcidin(DCD) expressed in E.coli

Human Dermcidin (DCD)
1-CSB-EP006537HUa6
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 23.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Dermcidin(DCD) expressed in E.coli

Human Dermcidin, DCD ELISA KIT
ELI-28148h 96 Tests
EUR 824

Human Dermcidin (DCD) ELISA Kit
20-abx151294
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Dermcidin (DCD) ELISA Kit
abx257296-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human Dermcidin (DCD) ELISA Kit
SEC896Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Dermcidin (DCD) ELISA Kit
SEC896Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Dermcidin (DCD) ELISA Kit
SEC896Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Dermcidin (DCD) ELISA Kit
SEC896Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Dermcidin (DCD) ELISA Kit
4-SEC896Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dermcidin elisa. Alternative names of the recognized antigen: HCAP
  • AIDD
  • DCD1
  • DSEP
  • PIF
  • Proteolysis Inducing Factor
  • Preproteolysin
  • Diffusible Survival/Evasion Peptide
  • Survival Promoting Peptide
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dermcidin (DCD) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Dermcidin ELISA Kit (DCD)
RK01249 96 Tests
EUR 521

Rat Dermcidin (DCD) ELISA Kit
20-abx155435
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Dermcidin (DCD) ELISA Kit
SEC896Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Dermcidin (DCD) ELISA Kit
SEC896Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Dermcidin (DCD) ELISA Kit
SEC896Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Dermcidin (DCD) ELISA Kit
SEC896Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Dermcidin (DCD) ELISA Kit
4-SEC896Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dermcidin elisa. Alternative names of the recognized antigen: HCAP
  • AIDD
  • DCD1
  • DSEP
  • PIF
  • Proteolysis Inducing Factor
  • Preproteolysin
  • Diffusible Survival/Evasion Peptide
  • Survival Promoting Peptide
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Dermcidin (DCD) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Dermcidin ELISA Kit (DCD)
RK03614 96 Tests
EUR 521

Dermcidin (DCD) Antibody
20-abx109721
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dermcidin (DCD) Antibody
20-abx141389
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dermcidin (DCD) Antibody
20-abx100245
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dermcidin (DCD) Antibody
abx032955-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dermcidin (DCD) Antibody
abx032955-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dermcidin (DCD) Antibody
20-abx005487
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dermcidin (DCD) Antibody
20-abx172090
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dermcidin (DCD) Antibody
20-abx172091
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dermcidin (DCD) Antibody
20-abx176148
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dermcidin (DCD) Antibody
abx232263-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Recombinant Dermcidin (DCD)
4-RPC896Hu01
  • EUR 504.99
  • EUR 238.00
  • EUR 1618.72
  • EUR 606.24
  • EUR 1112.48
  • EUR 401.00
  • EUR 3896.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P81605
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 11.0kDa
  • Isoelectric Point: 6.2
Description: Recombinant Human Dermcidin expressed in: E.coli

ELISA kit for Human DCD (Dermcidin)
ELK2908 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dermcidin (DCD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dermcidin (DCD). N
  • Show more
Description: A sandwich ELISA kit for detection of Dermcidin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Dermcidin (DCD) CLIA Kit
20-abx493964
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Dermcidin (DCD) Protein
20-abx066308
  • EUR 704.00
  • EUR 286.00
  • EUR 2179.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

ELISA kit for Rat DCD (Dermcidin)
ELK6013 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dermcidin (DCD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dermcidin (DCD). N
  • Show more
Description: A sandwich ELISA kit for detection of Dermcidin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Dermcidin (DCD) CLIA Kit
20-abx493965
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Dermcidin (DCD) Protein
20-abx653162
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Dermcidin (DCD) Antibody (HRP)
20-abx108177
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dermcidin (DCD) Antibody (Biotin)
20-abx105339
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dermcidin (DCD) Antibody (FITC)
20-abx106758
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dermcidin (DCD) Antibody (Biotin)
20-abx272301
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Dermcidin (DCD) Polyclonal Antibody (Human)
4-PAC896Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCD (Cys18~Leu110)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD)

Dermcidin (DCD) Polyclonal Antibody (Human), APC
4-PAC896Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCD (Cys18~Leu110)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with APC.

Dermcidin (DCD) Polyclonal Antibody (Human), Biotinylated
4-PAC896Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCD (Cys18~Leu110)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with Biotin.

Dermcidin (DCD) Polyclonal Antibody (Human), Cy3
4-PAC896Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCD (Cys18~Leu110)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with Cy3.

Dermcidin (DCD) Polyclonal Antibody (Human), FITC
4-PAC896Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCD (Cys18~Leu110)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with FITC.

Dermcidin (DCD) Polyclonal Antibody (Human), HRP
4-PAC896Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCD (Cys18~Leu110)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with HRP.

Dermcidin (DCD) Polyclonal Antibody (Human), PE
4-PAC896Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCD (Cys18~Leu110)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with PE.

Human PIF/DCD(Proteolysis Inducing Factor/Dermcidin) ELISA Kit
EH4251 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P81605
  • Alias: AIDD, DCD-1, DSEP, HCAP, MGC71930, PIF, diffusible survival/evasion peptide|preproteolysin|proteolysis inducing factor|survival promoting peptide
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Proteolysis Inducing Factor/Dermcidin(PIF/DCD)ELISA Kit
CSB-E13626h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD) in samples from serum, plasma, cell culture supernates, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Proteolysis Inducing Factor/Dermcidin(PIF/DCD)ELISA Kit
1-CSB-E13626h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Proteolysis Inducing Factor/Dermcidin(PIF/DCD) in samples from serum, plasma, cell culture supernates, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Dermcidin (DCD) Polyclonal Antibody (Human), APC-Cy7
4-PAC896Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCD (Cys18~Leu110)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with APC-Cy7.

ELISA kit for Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD)
KTE62411-48T 48T
EUR 354
  • Dermcidin is a secreted protein that is subsequently processed into mature peptides of distinct biological activities. The C-terminal peptide is constitutively expressed in sweat and has antibacterial and antifungal activities. The N-terminal peptide
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD)
KTE62411-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Dermcidin is a secreted protein that is subsequently processed into mature peptides of distinct biological activities. The C-terminal peptide is constitutively expressed in sweat and has antibacterial and antifungal activities. The N-terminal peptide
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD)
KTE62411-96T 96T
EUR 572
  • Dermcidin is a secreted protein that is subsequently processed into mature peptides of distinct biological activities. The C-terminal peptide is constitutively expressed in sweat and has antibacterial and antifungal activities. The N-terminal peptide
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-100ug
QP5914-ec-100ug 100ug
EUR 408

Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-10ug
QP5914-ec-10ug 10ug
EUR 200

Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-1mg
QP5914-ec-1mg 1mg
EUR 1632

Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-200ug
QP5914-ec-200ug 200ug
EUR 634

Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-500ug
QP5914-ec-500ug 500ug
EUR 1060

Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-50ug
QP5914-ec-50ug 50ug
EUR 263

Recombinant Human Dermcidin/ DCD Protein, His, Yeast-100ug
QP5914-ye-100ug 100ug
EUR 480

Recombinant Human Dermcidin/ DCD Protein, His, Yeast-10ug
QP5914-ye-10ug 10ug
EUR 236

Recombinant Human Dermcidin/ DCD Protein, His, Yeast-1mg
QP5914-ye-1mg 1mg
EUR 1885

Recombinant Human Dermcidin/ DCD Protein, His, Yeast-200ug
QP5914-ye-200ug 200ug
EUR 744

Recombinant Human Dermcidin/ DCD Protein, His, Yeast-500ug
QP5914-ye-500ug 500ug
EUR 1206

Recombinant Human Dermcidin/ DCD Protein, His, Yeast-50ug
QP5914-ye-50ug 50ug
EUR 299

Dermcidin
D077-5MG 5mg
EUR 349

PIF/DCD ELISA KIT|Human
EF007421 96 Tests
EUR 689

DCD ELISA Kit (Human) (OKCD01277)
OKCD01277 96 Wells
EUR 831
Description: Description of target: DCD-1 displays antimicrobial activity thereby limiting skin infection by potential pathogens in the first few hours after bacterial colonization. Highly effective against E.coli, E.faecalis, S.aureus and C.albicans. Optimal pH and salt concentration resemble the conditions in sweat. Also exhibits proteolytic activity. Survival-promoting peptide promotes survival of neurons and displays phosphatase activity. It may bind IgG. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.31 ng/mL

DCD ELISA Kit (Human) (OKAN06409)
OKAN06409 96 Wells
EUR 792
Description: Description of target: This antimicrobial gene encodes a secreted protein that is subsequently processed into mature peptides of distinct biological activities. The C-terminal peptide is constitutively expressed in sweat and has antibacterial and antifungal activities. The N-terminal peptide, also known as diffusible survival evasion peptide, promotes neural cell survival under conditions of severe oxidative stress. A glycosylated form of the N-terminal peptide may be associated with cachexia (muscle wasting) in cancer patients. Alternative splicing results in multiple transcript variants encoding different isoforms.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.31 ng/mL

Dermcidin-1L (human)
H-7316.0500 0.5mg
EUR 177
Description: Sum Formula: C210H359N57O71; CAS# [478898-18-9] net

Dermcidin-1L (human)
H-7316.1000 1.0mg
EUR 294
Description: Sum Formula: C210H359N57O71; CAS# [478898-18-9] net

DCD ELISA Kit (Rat) (OKAN06433)
OKAN06433 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL

DCD ELISA Kit (Rat) (OKDD00644)
OKDD00644 96 Wells
EUR 1040
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.057 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202

DCD siRNA
20-abx913661
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DCD Antibody
47246-100ul 100ul
EUR 252

DCD Antibody
1-CSB-PA006537DA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DCD. Recognizes DCD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

Human DCD shRNA Plasmid
20-abx964554
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DCD Recombinant Protein (Human)
RP008806 100 ug Ask for price

Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

DCD Conjugated Antibody
C47246 100ul
EUR 397

DCD cloning plasmid
CSB-CL006537HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 333
  • Sequence: atgaggttcatgactctcctcttcctgacagctctggcaggagccctggtctgtgcctatgatccagaggccgcctctgccccaggatcggggaacccttgccatgaagcatcagcagctcaaaaggaaaatgcaggtgaagacccagggttagccagacaggcaccaaagccaag
  • Show more
Description: A cloning plasmid for the DCD gene.

anti- DCD antibody
FNab02263 100µg
EUR 585
  • Immunogen: dermcidin
  • Uniprot ID: P81605
  • Gene ID: 117159
  • Research Area: Immunology
Description: Antibody raised against DCD

DCD Polyclonal Antibody
A53288 100 µg
EUR 570.55
Description: Ask the seller for details

DCD Rabbit pAb
A7280-100ul 100 ul
EUR 308

DCD Rabbit pAb
A7280-200ul 200 ul
EUR 459

DCD Rabbit pAb
A7280-20ul 20 ul
EUR 183

DCD Rabbit pAb
A7280-50ul 50 ul
EUR 223

Human DCD(Dermcidin) ELISA Kit