Human AADAT(Aminoadipate Aminotransferase) ELISA Kit
Human Aminoadipate Aminotransferase (AADAT) ELISA Kit |
RDR-AADAT-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Aminoadipate Aminotransferase (AADAT) ELISA Kit |
RDR-AADAT-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Aminoadipate Aminotransferase (AADAT) ELISA Kit |
20-abx150492 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Aminoadipate Aminotransferase (AADAT) ELISA Kit |
abx570675-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Aminoadipate Aminotransferase (AADAT) ELISA Kit |
SED856Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aminoadipate Aminotransferase (AADAT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aminoadipate Aminotransferase (AADAT) in Tissue homogenates and other biological fluids. |
Human Aminoadipate Aminotransferase (AADAT) ELISA Kit |
SED856Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aminoadipate Aminotransferase (AADAT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aminoadipate Aminotransferase (AADAT) in Tissue homogenates and other biological fluids. |
Human Aminoadipate Aminotransferase (AADAT) ELISA Kit |
SED856Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aminoadipate Aminotransferase (AADAT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aminoadipate Aminotransferase (AADAT) in Tissue homogenates and other biological fluids. |
Human Aminoadipate Aminotransferase (AADAT) ELISA Kit |
SED856Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aminoadipate Aminotransferase (AADAT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aminoadipate Aminotransferase (AADAT) in Tissue homogenates and other biological fluids. |
Human Aminoadipate Aminotransferase (AADAT) ELISA Kit |
4-SED856Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Aminoadipate Aminotransferase elisa. Alternative names of the recognized antigen: KATII
- KAT2
- Kynurenine Aminotransferase II
- L Kynurenine/Alpha Aminoadipate Aminotransferase
- Kynurenine aminotransferase II
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Aminoadipate Aminotransferase (AADAT) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Aminoadipate Aminotransferase (AADAT) Antibody |
20-abx110948 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Aminoadipate Aminotransferase (AADAT) Antibody |
20-abx131228 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Aminoadipate Aminotransferase (AADAT) Antibody |
20-abx131229 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Aminoadipate Aminotransferase (AADAT) Antibody |
abx122386-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Aminoadipate Aminotransferase (AADAT) Antibody |
20-abx171194 |
Abbexa |
|
|
|
Aminoadipate Aminotransferase (AADAT) Antibody |
abx432251-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Aminoadipate Aminotransferase (AADAT) Antibody |
abx432252-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Aminoadipate Aminotransferase (AADAT) Antibody |
20-abx301574 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Aminoadipate Aminotransferase (AADAT) Antibody |
abx230018-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Recombinant Aminoadipate Aminotransferase (AADAT) |
4-RPD856Hu01 |
Cloud-Clone |
-
EUR 429.73
-
EUR 218.00
-
EUR 1336.48
-
EUR 512.16
-
EUR 924.32
-
EUR 350.00
-
EUR 3191.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q8N5Z0
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 29.0kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Aminoadipate Aminotransferase expressed in: E.coli |
Recombinant Aminoadipate Aminotransferase (AADAT) |
4-RPD856Mu01 |
Cloud-Clone |
-
EUR 456.61
-
EUR 225.00
-
EUR 1437.28
-
EUR 545.76
-
EUR 991.52
-
EUR 368.00
-
EUR 3443.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9WVM8
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 40.4kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Aminoadipate Aminotransferase expressed in: E.coli |
Rat Aminoadipate Aminotransferase (AADAT) ELISA Kit |
abx256458-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Mouse Aminoadipate Aminotransferase (AADAT) ELISA Kit |
abx516042-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Human Aminoadipate Aminotransferase (AADAT) Protein |
20-abx650511 |
Abbexa |
-
EUR 606.00
-
EUR 258.00
-
EUR 1803.00
-
EUR 718.00
-
EUR 439.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Aminoadipate Aminotransferase (AADAT) CLIA Kit |
20-abx494414 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human AADAT (Aminoadipate Aminotransferase) |
ELK3121 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Aminoadipate Aminotransferase (AADAT). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
- Show more
|
Description: A sandwich ELISA kit for detection of Aminoadipate Aminotransferase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Aminoadipate Aminotransferase (AADAT) Antibody (HRP) |
20-abx309664 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Aminoadipate Aminotransferase (AADAT) Antibody (FITC) |
20-abx309665 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Aminoadipate Aminotransferase (AADAT) Antibody (Biotin) |
20-abx309666 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mouse Aminoadipate Aminotransferase (AADAT) Protein |
20-abx650512 |
Abbexa |
-
EUR 634.00
-
EUR 272.00
-
EUR 1943.00
-
EUR 759.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Human) |
4-PAD856Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AADAT (Asn202~Ser425)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Aminoadipate Aminotransferase (AADAT) |
Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Mouse) |
4-PAD856Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AADAT (Thr99~Leu425)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Aminoadipate Aminotransferase (AADAT) |
Human Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial (AADAT) |
1-CSB-EP843276HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 60.2 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial(AADAT) expressed in E.coli |
Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Human), APC |
4-PAD856Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AADAT (Asn202~Ser425)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Aminoadipate Aminotransferase (AADAT). This antibody is labeled with APC. |
Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Human), Biotinylated |
4-PAD856Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AADAT (Asn202~Ser425)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Aminoadipate Aminotransferase (AADAT). This antibody is labeled with Biotin. |
Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Human), Cy3 |
4-PAD856Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AADAT (Asn202~Ser425)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Aminoadipate Aminotransferase (AADAT). This antibody is labeled with Cy3. |
Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Human), FITC |
4-PAD856Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AADAT (Asn202~Ser425)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Aminoadipate Aminotransferase (AADAT). This antibody is labeled with FITC. |
Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Human), HRP |
4-PAD856Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AADAT (Asn202~Ser425)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Aminoadipate Aminotransferase (AADAT). This antibody is labeled with HRP. |
Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Human), PE |
4-PAD856Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AADAT (Asn202~Ser425)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Aminoadipate Aminotransferase (AADAT). This antibody is labeled with PE. |
Human AADAT/ Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial ELISA Kit |
E0003Hu |
Sunlong |
1 Kit |
EUR 605 |
Human AADAT(Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial) ELISA Kit |
EH1430 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.312-20 ng/ml
- Uniprot ID: Q8N5Z0
- Alias: AADAT(Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial)/(KAT/AadAT)/Kynurenine aminotransferase II/2-aminoadipate aminotransferase
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Mouse Aadat/ Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial ELISA Kit |
E0001Mo |
Sunlong |
1 Kit |
EUR 632 |
Rat Aadat/ Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial ELISA Kit |
E0002Ra |
Sunlong |
1 Kit |
EUR 646 |
Rat Aadat(Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial) ELISA Kit |
ER0481 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q64602
- Alias: Aadat/AADAT/KAT2/AadAT/aminoadipate aminotransferase/EC 2.6.1.39,2-aminoadipate aminotransferase/EC 2.6.1.7,2-aminoadipate transaminase/KAT/AadAT/KAT2mitochondrial/Kynurenine aminotransferase
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml |
Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Mouse), APC |
4-PAD856Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AADAT (Thr99~Leu425)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Aminoadipate Aminotransferase (AADAT). This antibody is labeled with APC. |
Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Mouse), Biotinylated |
4-PAD856Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AADAT (Thr99~Leu425)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Aminoadipate Aminotransferase (AADAT). This antibody is labeled with Biotin. |
Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Mouse), Cy3 |
4-PAD856Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AADAT (Thr99~Leu425)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Aminoadipate Aminotransferase (AADAT). This antibody is labeled with Cy3. |
Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Mouse), FITC |
4-PAD856Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AADAT (Thr99~Leu425)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Aminoadipate Aminotransferase (AADAT). This antibody is labeled with FITC. |
Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Mouse), HRP |
4-PAD856Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AADAT (Thr99~Leu425)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Aminoadipate Aminotransferase (AADAT). This antibody is labeled with HRP. |
Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Mouse), PE |
4-PAD856Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AADAT (Thr99~Leu425)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Aminoadipate Aminotransferase (AADAT). This antibody is labeled with PE. |
ELISA kit for Human Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial (AADAT) |
KTE60844-48T |
Abbkine |
48T |
EUR 332 |
- Aminoadipate Aminotransferase is highly similar to mouse and rat kynurenine aminotransferase II. The rat protein is a homodimer with two transaminase activities. One activity is the transamination of alpha-aminoadipic acid, a final step in the saccar
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial (AADAT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial (AADAT) |
KTE60844-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Aminoadipate Aminotransferase is highly similar to mouse and rat kynurenine aminotransferase II. The rat protein is a homodimer with two transaminase activities. One activity is the transamination of alpha-aminoadipic acid, a final step in the saccar
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial (AADAT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial (AADAT) |
KTE60844-96T |
Abbkine |
96T |
EUR 539 |
- Aminoadipate Aminotransferase is highly similar to mouse and rat kynurenine aminotransferase II. The rat protein is a homodimer with two transaminase activities. One activity is the transamination of alpha-aminoadipic acid, a final step in the saccar
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial (AADAT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Human), APC-Cy7 |
4-PAD856Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AADAT (Asn202~Ser425)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Aminoadipate Aminotransferase (AADAT). This antibody is labeled with APC-Cy7. |
Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAD856Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AADAT (Thr99~Leu425)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Aminoadipate Aminotransferase (AADAT). This antibody is labeled with APC-Cy7. |
anti-Aminoadipate aminotransferase |
YF-PA18895 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to Aminoadipate aminotransferase |
anti-Aminoadipate aminotransferase |
YF-PA18896 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to Aminoadipate aminotransferase |
anti-Aminoadipate aminotransferase |
YF-PA18897 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to Aminoadipate aminotransferase |
anti-Aminoadipate aminotransferase |
YF-PA26145 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to Aminoadipate aminotransferase |
Aadat ELISA Kit| Rat Kynurenine/alpha-aminoadipate aminotransfer |
EF017321 |
Lifescience Market |
96 Tests |
EUR 689 |
Aadat ELISA Kit| Mouse Kynurenine/alpha-aminoadipate aminotrans |
EF015333 |
Lifescience Market |
96 Tests |
EUR 689 |
AADAT ELISA Kit| Bovine Kynurenine/alpha-aminoadipate aminotran |
EF011543 |
Lifescience Market |
96 Tests |
EUR 689 |
ELISA kit for Human Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial |
EK3062 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Rat Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial |
EK3061 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human Aminoadipate-Semialdehyde Dehydrogenase (AASDH) ELISA Kit |
abx251777-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Human Alanine Aminotransferase ELISA kit |
E01A0388-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Alanine Aminotransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Alanine Aminotransferase ELISA kit |
E01A0388-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Alanine Aminotransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Aspartate Aminotransferase ELISA kit |
E01A0626-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Aspartate Aminotransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Aspartate Aminotransferase ELISA kit |
E01A0626-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Aspartate Aminotransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Aspartate Aminotransferase ELISA kit |
E01A0626-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Aspartate Aminotransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human glutamine Aminotransferase ELISA kit |
E01G0460-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human glutamine Aminotransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human glutamine Aminotransferase ELISA kit |
E01G0460-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human glutamine Aminotransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human glutamine Aminotransferase ELISA kit |
E01G0460-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human glutamine Aminotransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
AADAT antibody |
70R-1120 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal AADAT antibody raised against the N terminal of AADAT |
AADAT antibody |
70R-2917 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal AADAT antibody raised against the middle region of AADAT |
AADAT antibody |
70R-15494 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal AADAT antibody |
AADAT Antibody |
1-CSB-PA843276LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AADAT. Recognizes AADAT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
AADAT Antibody |
1-CSB-PA001019GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against AADAT. Recognizes AADAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
AADAT Antibody |
DF12804 |
Affbiotech |
200ul |
EUR 304 |
Description: AADAT Antibody detects endogenous levels of AADAT. |
AADAT siRNA |
20-abx900048 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AADAT siRNA |
20-abx906246 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AADAT siRNA |
20-abx906247 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit |
DLR-AASDHPPT-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) in samples from tissue homogenates or other biological fluids. |
Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit |
DLR-AASDHPPT-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) in samples from tissue homogenates or other biological fluids. |
Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit |
RD-AASDHPPT-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit |
RD-AASDHPPT-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit |
RDR-AASDHPPT-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit |
RDR-AASDHPPT-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit |
SEC272Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- I
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) in Tissue homogenates and other biological fluids. |
Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit |
SEC272Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- I
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) in Tissue homogenates and other biological fluids. |
Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit |
SEC272Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- I
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) in Tissue homogenates and other biological fluids. |
Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit |
SEC272Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- I
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) in Tissue homogenates and other biological fluids. |
Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit |
4-SEC272Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Aminoadipate Semialdehyde Phosphopantetheinyl Transferase elisa. Alternative names of the recognized antigen: AASD-PPT
- CGI80
- LYS2
- LYS5
- 4'-phosphopantetheinyl transferase
- LYS5 ortholog
- Alpha-aminoadipic semialdehyde dehydrogenase-p
- Show more
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human AADAT shRNA Plasmid |
20-abx959576 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
AADAT Recombinant Protein (Human) |
RP000028 |
ABM |
100 ug |
Ask for price |
Mouse Aminoadipate-Semialdehyde Dehydrogenase (AASDH) ELISA Kit |
abx520891-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Human Aminoadipate Semialdehyde Dehydrogenase Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit |
20-abx150495 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
ELISA kit for Human AASDHPPT (Aminoadipate Semialdehyde Phosphopantetheinyl Transferase) |
ELK4643 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT). Standards or samples are then added to the appropriate microtiter plate wells with a biot
- Show more
|
Description: A sandwich ELISA kit for detection of Aminoadipate Semialdehyde Phosphopantetheinyl Transferase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Aspartate aminotransferase,AST ELISA Kit |
201-12-0887 |
SunredBio |
96 tests |
EUR 440 |
- This Aspartate aminotransferase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Alanine Aminotransferase (ALT) ELISA Kit |
DLR-ALT-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Alanine Aminotransferase (ALT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Alanine Aminotransferase (ALT) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Alanine Aminotransferase (ALT) ELISA Kit |
DLR-ALT-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Alanine Aminotransferase (ALT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Alanine Aminotransferase (ALT) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Aspartate Aminotransferase (AST) ELISA Kit |
DLR-AST-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Aspartate Aminotransferase (AST) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Aspartate Aminotransferase (AST) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Aspartate Aminotransferase (AST) ELISA Kit |
DLR-AST-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Aspartate Aminotransferase (AST) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Aspartate Aminotransferase (AST) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Aspartate aminotransferase,AST ELISA kit |
E01A1880-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Aspartate aminotransferase,AST in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Aspartate aminotransferase,AST ELISA kit |
E01A1880-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Aspartate aminotransferase,AST in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Aspartate aminotransferase,AST ELISA kit |
E01A1880-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Aspartate aminotransferase,AST in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Aspartate Aminotransferase (AST) ELISA Kit |
20-abx150760 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Ornithine Aminotransferase (OAT) ELISA Kit |
20-abx152577 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Aspartate Aminotransferase (GOT1) ELISA Kit |
abx252048-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human AST(Aspartate Aminotransferase) ELISA Kit |
EH2671 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.313-20 ng/ml
- Uniprot ID: Q9NRA2
- Alias: AST
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Human Aspartate aminotransferase, AST ELISA Kit |
ELA-E1214h |
Lifescience Market |
96 Tests |
EUR 824 |
Aspartate Aminotransferase (AST) (Human) ELISA Kit |
E4319-100 |
Biovision |
|
EUR 805 |
Human Tyrosine aminotransferase, TAT ELISA KIT |
ELI-24055h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Phosphoserine aminotransferase, PSAT1 ELISA KIT |
ELI-30408h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Aspartate aminotransferase,AST ELISA Kit |
CN-04514H1 |
ChemNorm |
96T |
EUR 454 |
Human Aspartate aminotransferase,AST ELISA Kit |
CN-04514H2 |
ChemNorm |
48T |
EUR 303 |
Human Aspartate aminotransferase, AST ELISA Kit |
CSB-E09603h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Aspartate aminotransferase, AST in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Aspartate aminotransferase, AST ELISA Kit |
1-CSB-E09603h |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Aspartate aminotransferase, AST in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Aspartate aminotransferase(AST)ELISA Kit |
GA-E0903HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human Aspartate aminotransferase(AST)ELISA Kit |
GA-E0903HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human Alanine Aminotransferase (ALT) ELISA Kit |
RD-ALT-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Alanine Aminotransferase (ALT) ELISA Kit |
RD-ALT-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Human Alanine Aminotransferase ELISA Kit (ALT) |
RK00873 |
Abclonal |
96 Tests |
EUR 521 |
Human Aspartate Aminotransferase ELISA Kit (AST) |
RK00953 |
Abclonal |
96 Tests |
EUR 521 |
Human Ornithine Aminotransferase ELISA Kit (OAT) |
RK01981 |
Abclonal |
96 Tests |
EUR 521 |
Human Aspartate Aminotransferase (AST) ELISA Kit |
RDR-AST-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Aspartate Aminotransferase (AST) ELISA Kit |
RDR-AST-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Human Alanine Aminotransferase (ALT) ELISA Kit |
RDR-ALT-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Alanine Aminotransferase (ALT) ELISA Kit |
RDR-ALT-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Ornithine Aminotransferase (OAT) ELISA Kit |
SED860Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ornithine Aminotransferase (OAT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ornithine Aminotransferase (OAT) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Ornithine Aminotransferase (OAT) ELISA Kit |
SED860Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ornithine Aminotransferase (OAT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ornithine Aminotransferase (OAT) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Ornithine Aminotransferase (OAT) ELISA Kit |
SED860Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ornithine Aminotransferase (OAT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ornithine Aminotransferase (OAT) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Ornithine Aminotransferase (OAT) ELISA Kit |
SED860Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ornithine Aminotransferase (OAT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ornithine Aminotransferase (OAT) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Ornithine Aminotransferase (OAT) ELISA Kit |
4-SED860Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Ornithine Aminotransferase elisa. Alternative names of the recognized antigen: HOGA
- Grate Arophy
- Ornithine delta-aminotransferase
- Ornithine--oxo-acid aminotransferase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ornithine Aminotransferase (OAT) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Alanine Aminotransferase (ALT) ELISA Kit |
SEA207Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4273.35 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Alanine Aminotransferase (ALT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Alanine Aminotransferase (ALT) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Alanine Aminotransferase (ALT) ELISA Kit |
SEA207Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 439.57 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Alanine Aminotransferase (ALT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Alanine Aminotransferase (ALT) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Alanine Aminotransferase (ALT) ELISA Kit |
SEA207Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 585.1 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Alanine Aminotransferase (ALT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Alanine Aminotransferase (ALT) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Alanine Aminotransferase (ALT) ELISA Kit |
SEA207Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2332.95 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Alanine Aminotransferase (ALT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Alanine Aminotransferase (ALT) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Alanine Aminotransferase (ALT) ELISA Kit |
4-SEA207Hu |
Cloud-Clone |
-
EUR 4324.00
-
EUR 2283.00
-
EUR 586.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Alanine Aminotransferase elisa. Alternative names of the recognized antigen: GPT
- ALAT
- SGPT
- AAT1
- GPT1
- Serum Glutamic Pyruvic Transaminase
- Alanine Transaminase
- Glutamate pyruvate transaminase 1
- Glutamic--alanine transaminase 1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Alanine Aminotransferase (ALT) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Aspartate Aminotransferase (AST) ELISA Kit |
SEB214Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aspartate Aminotransferase (AST) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aspartate Aminotransferase (AST) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Aspartate Aminotransferase (AST) ELISA Kit |
SEB214Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aspartate Aminotransferase (AST) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aspartate Aminotransferase (AST) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Aspartate Aminotransferase (AST) ELISA Kit |
SEB214Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aspartate Aminotransferase (AST) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aspartate Aminotransferase (AST) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Aspartate Aminotransferase (AST) ELISA Kit |
SEB214Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aspartate Aminotransferase (AST) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aspartate Aminotransferase (AST) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Aspartate Aminotransferase (AST) ELISA Kit |
4-SEB214Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Aspartate Aminotransferase elisa. Alternative names of the recognized antigen: cCAT
- AAT
- ASAT
- SGOT
- GOT1
- Cysteine transaminase, cytoplasmic
- Transaminase A
- Aspartate Transaminase 1, Cytoplasmic
- Glutamic-Oxaloacetic Transaminase 1,
- Show more
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Aspartate Aminotransferase (AST) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Aspartate Aminotransferase (AST) ELISA Kit |
RD-AST-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Aspartate Aminotransferase (AST) ELISA Kit |
RD-AST-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
AADAT Polyclonal Antibody |
27892-100ul |
SAB |
100ul |
EUR 252 |
AADAT Polyclonal Antibody |
27892-50ul |
SAB |
50ul |
EUR 187 |
AADAT Polyclonal Antibody |
27893-100ul |
SAB |
100ul |
EUR 252 |
AADAT Polyclonal Antibody |
27893-50ul |
SAB |
50ul |
EUR 187 |
AADAT Rabbit pAb |
A13089-100ul |
Abclonal |
100 ul |
EUR 308 |
AADAT Rabbit pAb |
A13089-200ul |
Abclonal |
200 ul |
EUR 459 |
AADAT Rabbit pAb |
A13089-20ul |
Abclonal |
20 ul |
EUR 183 |
AADAT Rabbit pAb |
A13089-50ul |
Abclonal |
50 ul |
EUR 223 |
AADAT Rabbit pAb |
A13090-100ul |
Abclonal |
100 ul |
EUR 308 |
AADAT Rabbit pAb |
A13090-200ul |
Abclonal |
200 ul |
EUR 459 |
AADAT Rabbit pAb |
A13090-20ul |
Abclonal |
20 ul |
EUR 183 |
AADAT Rabbit pAb |
A13090-50ul |
Abclonal |
50 ul |
EUR 223 |
AADAT Blocking Peptide |
33R-2491 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AADAT antibody, catalog no. 70R-2917 |
AADAT Blocking Peptide |
33R-1601 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AADAT antibody, catalog no. 70R-1120 |
AADAT Blocking Peptide |
DF12804-BP |
Affbiotech |
1mg |
EUR 195 |
AADAT cloning plasmid |
CSB-CL843276HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1290
- Sequence: atgaattacgcacggttcatcacggcagcgagcgcagccagaaacccttctcccatccggaccatgagtgagaaacgggctgacatattgagcagaggaccaaaatcgatgatctccttggctggtggcttaccaaatccaaacatgtttccttttaagactgccgtaatcactg
- Show more
|
Description: A cloning plasmid for the AADAT gene. |
AADAT Polyclonal Antibody |
A66746 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Human AADAT(Aminoadipate Aminotransferase) ELISA Kit