Human AADAT(Aminoadipate Aminotransferase) ELISA Kit

Human AADAT(Aminoadipate Aminotransferase) ELISA Kit

Human Aminoadipate Aminotransferase (AADAT) ELISA Kit

RDR-AADAT-Hu-48Tests 48 Tests
EUR 544

Human Aminoadipate Aminotransferase (AADAT) ELISA Kit

RDR-AADAT-Hu-96Tests 96 Tests
EUR 756

Human Aminoadipate Aminotransferase (AADAT) ELISA Kit

20-abx150492
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Aminoadipate Aminotransferase (AADAT) ELISA Kit

abx570675-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Aminoadipate Aminotransferase (AADAT) ELISA Kit

SED856Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aminoadipate Aminotransferase (AADAT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aminoadipate Aminotransferase (AADAT) in Tissue homogenates and other biological fluids.

Human Aminoadipate Aminotransferase (AADAT) ELISA Kit

SED856Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aminoadipate Aminotransferase (AADAT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aminoadipate Aminotransferase (AADAT) in Tissue homogenates and other biological fluids.

Human Aminoadipate Aminotransferase (AADAT) ELISA Kit

SED856Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aminoadipate Aminotransferase (AADAT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aminoadipate Aminotransferase (AADAT) in Tissue homogenates and other biological fluids.

Human Aminoadipate Aminotransferase (AADAT) ELISA Kit

SED856Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aminoadipate Aminotransferase (AADAT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aminoadipate Aminotransferase (AADAT) in Tissue homogenates and other biological fluids.

Human Aminoadipate Aminotransferase (AADAT) ELISA Kit

4-SED856Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Aminoadipate Aminotransferase elisa. Alternative names of the recognized antigen: KATII
  • KAT2
  • Kynurenine Aminotransferase II
  • L Kynurenine/Alpha Aminoadipate Aminotransferase
  • Kynurenine aminotransferase II
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Aminoadipate Aminotransferase (AADAT) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Aminoadipate Aminotransferase (AADAT) Antibody

20-abx110948
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Aminoadipate Aminotransferase (AADAT) Antibody

20-abx131228
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Aminoadipate Aminotransferase (AADAT) Antibody

20-abx131229
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Aminoadipate Aminotransferase (AADAT) Antibody

abx122386-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Aminoadipate Aminotransferase (AADAT) Antibody

20-abx171194
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Aminoadipate Aminotransferase (AADAT) Antibody

abx432251-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Aminoadipate Aminotransferase (AADAT) Antibody

abx432252-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Aminoadipate Aminotransferase (AADAT) Antibody

20-abx301574
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Aminoadipate Aminotransferase (AADAT) Antibody

abx230018-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Recombinant Aminoadipate Aminotransferase (AADAT)

4-RPD856Hu01
  • EUR 429.73
  • EUR 218.00
  • EUR 1336.48
  • EUR 512.16
  • EUR 924.32
  • EUR 350.00
  • EUR 3191.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8N5Z0
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Aminoadipate Aminotransferase expressed in: E.coli

Recombinant Aminoadipate Aminotransferase (AADAT)

4-RPD856Mu01
  • EUR 456.61
  • EUR 225.00
  • EUR 1437.28
  • EUR 545.76
  • EUR 991.52
  • EUR 368.00
  • EUR 3443.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9WVM8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 40.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Aminoadipate Aminotransferase expressed in: E.coli

Rat Aminoadipate Aminotransferase (AADAT) ELISA Kit

abx256458-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse Aminoadipate Aminotransferase (AADAT) ELISA Kit

abx516042-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human Aminoadipate Aminotransferase (AADAT) Protein

20-abx650511
  • EUR 606.00
  • EUR 258.00
  • EUR 1803.00
  • EUR 718.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Aminoadipate Aminotransferase (AADAT) CLIA Kit

20-abx494414
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human AADAT (Aminoadipate Aminotransferase)

ELK3121 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Aminoadipate Aminotransferase (AADAT). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Aminoadipate Aminotransferase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Aminoadipate Aminotransferase (AADAT) Antibody (HRP)

20-abx309664
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Aminoadipate Aminotransferase (AADAT) Antibody (FITC)

20-abx309665
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Aminoadipate Aminotransferase (AADAT) Antibody (Biotin)

20-abx309666
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse Aminoadipate Aminotransferase (AADAT) Protein

20-abx650512
  • EUR 634.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Human)

4-PAD856Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AADAT (Asn202~Ser425)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Aminoadipate Aminotransferase (AADAT)

Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Mouse)

4-PAD856Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AADAT (Thr99~Leu425)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Aminoadipate Aminotransferase (AADAT)

Human Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial (AADAT)

1-CSB-EP843276HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 60.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial(AADAT) expressed in E.coli

Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Human), APC

4-PAD856Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AADAT (Asn202~Ser425)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Aminoadipate Aminotransferase (AADAT). This antibody is labeled with APC.

Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Human), Biotinylated

4-PAD856Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AADAT (Asn202~Ser425)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Aminoadipate Aminotransferase (AADAT). This antibody is labeled with Biotin.

Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Human), Cy3

4-PAD856Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AADAT (Asn202~Ser425)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Aminoadipate Aminotransferase (AADAT). This antibody is labeled with Cy3.

Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Human), FITC

4-PAD856Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AADAT (Asn202~Ser425)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Aminoadipate Aminotransferase (AADAT). This antibody is labeled with FITC.

Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Human), HRP

4-PAD856Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AADAT (Asn202~Ser425)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Aminoadipate Aminotransferase (AADAT). This antibody is labeled with HRP.

Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Human), PE

4-PAD856Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AADAT (Asn202~Ser425)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Aminoadipate Aminotransferase (AADAT). This antibody is labeled with PE.

Human AADAT/ Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial ELISA Kit

E0003Hu 1 Kit
EUR 605

Human AADAT(Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial) ELISA Kit

EH1430 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q8N5Z0
  • Alias: AADAT(Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial)/(KAT/AadAT)/Kynurenine aminotransferase II/2-aminoadipate aminotransferase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Mouse Aadat/ Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial ELISA Kit

E0001Mo 1 Kit
EUR 632

Rat Aadat/ Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial ELISA Kit

E0002Ra 1 Kit
EUR 646

Rat Aadat(Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial) ELISA Kit

ER0481 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q64602
  • Alias: Aadat/AADAT/KAT2/AadAT/aminoadipate aminotransferase/EC 2.6.1.39,2-aminoadipate aminotransferase/EC 2.6.1.7,2-aminoadipate transaminase/KAT/AadAT/KAT2mitochondrial/Kynurenine aminotransferase
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Mouse), APC

4-PAD856Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AADAT (Thr99~Leu425)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Aminoadipate Aminotransferase (AADAT). This antibody is labeled with APC.

Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Mouse), Biotinylated

4-PAD856Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AADAT (Thr99~Leu425)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Aminoadipate Aminotransferase (AADAT). This antibody is labeled with Biotin.

Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Mouse), Cy3

4-PAD856Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AADAT (Thr99~Leu425)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Aminoadipate Aminotransferase (AADAT). This antibody is labeled with Cy3.

Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Mouse), FITC

4-PAD856Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AADAT (Thr99~Leu425)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Aminoadipate Aminotransferase (AADAT). This antibody is labeled with FITC.

Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Mouse), HRP

4-PAD856Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AADAT (Thr99~Leu425)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Aminoadipate Aminotransferase (AADAT). This antibody is labeled with HRP.

Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Mouse), PE

4-PAD856Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AADAT (Thr99~Leu425)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Aminoadipate Aminotransferase (AADAT). This antibody is labeled with PE.

ELISA kit for Human Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial (AADAT)

KTE60844-48T 48T
EUR 332
  • Aminoadipate Aminotransferase is highly similar to mouse and rat kynurenine aminotransferase II. The rat protein is a homodimer with two transaminase activities. One activity is the transamination of alpha-aminoadipic acid, a final step in the saccar
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial (AADAT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial (AADAT)

KTE60844-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Aminoadipate Aminotransferase is highly similar to mouse and rat kynurenine aminotransferase II. The rat protein is a homodimer with two transaminase activities. One activity is the transamination of alpha-aminoadipic acid, a final step in the saccar
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial (AADAT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial (AADAT)

KTE60844-96T 96T
EUR 539
  • Aminoadipate Aminotransferase is highly similar to mouse and rat kynurenine aminotransferase II. The rat protein is a homodimer with two transaminase activities. One activity is the transamination of alpha-aminoadipic acid, a final step in the saccar
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial (AADAT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Human), APC-Cy7

4-PAD856Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AADAT (Asn202~Ser425)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Aminoadipate Aminotransferase (AADAT). This antibody is labeled with APC-Cy7.

Aminoadipate Aminotransferase (AADAT) Polyclonal Antibody (Mouse), APC-Cy7

4-PAD856Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AADAT (Thr99~Leu425)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Aminoadipate Aminotransferase (AADAT). This antibody is labeled with APC-Cy7.

anti-Aminoadipate aminotransferase

YF-PA18895 50 ug
EUR 363
Description: Mouse polyclonal to Aminoadipate aminotransferase

anti-Aminoadipate aminotransferase

YF-PA18896 100 ul
EUR 403
Description: Rabbit polyclonal to Aminoadipate aminotransferase

anti-Aminoadipate aminotransferase

YF-PA18897 100 ug
EUR 403
Description: Rabbit polyclonal to Aminoadipate aminotransferase

anti-Aminoadipate aminotransferase

YF-PA26145 50 ul
EUR 334
Description: Mouse polyclonal to Aminoadipate aminotransferase

Aadat ELISA Kit| Rat Kynurenine/alpha-aminoadipate aminotransfer

EF017321 96 Tests
EUR 689

Aadat ELISA Kit| Mouse Kynurenine/alpha-aminoadipate aminotrans

EF015333 96 Tests
EUR 689

AADAT ELISA Kit| Bovine Kynurenine/alpha-aminoadipate aminotran

EF011543 96 Tests
EUR 689

ELISA kit for Human Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial

EK3062 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Rat Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial

EK3061 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial in samples from serum, plasma, tissue homogenates and other biological fluids.

Aadat/ Rat Aadat ELISA Kit

ELI-24762r 96 Tests
EUR 886

Human AADAT ELISA Kit

ELA-E12537h 96 Tests
EUR 824

AADAT ELISA KIT|Human

EF009888 96 Tests
EUR 689

Human AADAT ELISA KIT

ELI-34899h 96 Tests
EUR 824

Mouse Aadat ELISA KIT

ELI-12135m 96 Tests
EUR 865

Bovine AADAT ELISA KIT

ELI-49761b 96 Tests
EUR 928

Human Aminoadipate-Semialdehyde Dehydrogenase (AASDH) ELISA Kit

abx251777-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human Alanine Aminotransferase ELISA kit

E01A0388-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Alanine Aminotransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alanine Aminotransferase ELISA kit

E01A0388-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Alanine Aminotransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aspartate Aminotransferase ELISA kit

E01A0626-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aspartate Aminotransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aspartate Aminotransferase ELISA kit

E01A0626-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aspartate Aminotransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aspartate Aminotransferase ELISA kit

E01A0626-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aspartate Aminotransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human glutamine Aminotransferase ELISA kit

E01G0460-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human glutamine Aminotransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human glutamine Aminotransferase ELISA kit

E01G0460-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human glutamine Aminotransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human glutamine Aminotransferase ELISA kit

E01G0460-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human glutamine Aminotransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

AADAT antibody

70R-1120 100 ug
EUR 377
Description: Rabbit polyclonal AADAT antibody raised against the N terminal of AADAT

AADAT antibody

70R-2917 50 ug
EUR 467
Description: Rabbit polyclonal AADAT antibody raised against the middle region of AADAT

AADAT antibody

70R-15494 50 ul
EUR 435
Description: Rabbit polyclonal AADAT antibody

AADAT Antibody

1-CSB-PA843276LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AADAT. Recognizes AADAT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

AADAT Antibody

1-CSB-PA001019GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against AADAT. Recognizes AADAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

AADAT Antibody

DF12804 200ul
EUR 304
Description: AADAT Antibody detects endogenous levels of AADAT.

AADAT siRNA

20-abx900048
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AADAT siRNA

20-abx906246
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AADAT siRNA

20-abx906247
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223-AADAT

PVT12156 2 ug
EUR 391

Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit

DLR-AASDHPPT-Hu-48T 48T
EUR 517
  • Should the Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) in samples from tissue homogenates or other biological fluids.

Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit

DLR-AASDHPPT-Hu-96T 96T
EUR 673
  • Should the Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) in samples from tissue homogenates or other biological fluids.

Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit

RD-AASDHPPT-Hu-48Tests 48 Tests
EUR 521

Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit

RD-AASDHPPT-Hu-96Tests 96 Tests
EUR 723

Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit

RDR-AASDHPPT-Hu-48Tests 48 Tests
EUR 544

Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit

RDR-AASDHPPT-Hu-96Tests 96 Tests
EUR 756

Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit

SEC272Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) in Tissue homogenates and other biological fluids.

Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit

SEC272Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) in Tissue homogenates and other biological fluids.

Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit

SEC272Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) in Tissue homogenates and other biological fluids.

Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit

SEC272Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) in Tissue homogenates and other biological fluids.

Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit

4-SEC272Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Aminoadipate Semialdehyde Phosphopantetheinyl Transferase elisa. Alternative names of the recognized antigen: AASD-PPT
  • CGI80
  • LYS2
  • LYS5
  • 4'-phosphopantetheinyl transferase
  • LYS5 ortholog
  • Alpha-aminoadipic semialdehyde dehydrogenase-p
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human AADAT shRNA Plasmid

20-abx959576
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

AADAT Recombinant Protein (Human)

RP000028 100 ug Ask for price

Mouse Aminoadipate-Semialdehyde Dehydrogenase (AASDH) ELISA Kit

abx520891-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human Aminoadipate Semialdehyde Dehydrogenase Phosphopantetheinyl Transferase (AASDHPPT) ELISA Kit

20-abx150495
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

ELISA kit for Human AASDHPPT (Aminoadipate Semialdehyde Phosphopantetheinyl Transferase)

ELK4643 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Aminoadipate Semialdehyde Phosphopantetheinyl Transferase (AASDHPPT). Standards or samples are then added to the appropriate microtiter plate wells with a biot
  • Show more
Description: A sandwich ELISA kit for detection of Aminoadipate Semialdehyde Phosphopantetheinyl Transferase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Aspartate aminotransferase,AST ELISA Kit

201-12-0887 96 tests
EUR 440
  • This Aspartate aminotransferase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Alanine Aminotransferase (ALT) ELISA Kit

DLR-ALT-Hu-48T 48T
EUR 479
  • Should the Human Alanine Aminotransferase (ALT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Alanine Aminotransferase (ALT) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Alanine Aminotransferase (ALT) ELISA Kit

DLR-ALT-Hu-96T 96T
EUR 621
  • Should the Human Alanine Aminotransferase (ALT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Alanine Aminotransferase (ALT) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Aspartate Aminotransferase (AST) ELISA Kit

DLR-AST-Hu-48T 48T
EUR 498
  • Should the Human Aspartate Aminotransferase (AST) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aspartate Aminotransferase (AST) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Aspartate Aminotransferase (AST) ELISA Kit

DLR-AST-Hu-96T 96T
EUR 647
  • Should the Human Aspartate Aminotransferase (AST) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aspartate Aminotransferase (AST) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Aspartate aminotransferase,AST ELISA kit

E01A1880-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aspartate aminotransferase,AST in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aspartate aminotransferase,AST ELISA kit

E01A1880-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aspartate aminotransferase,AST in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aspartate aminotransferase,AST ELISA kit

E01A1880-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aspartate aminotransferase,AST in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aspartate Aminotransferase (AST) ELISA Kit

20-abx150760
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ornithine Aminotransferase (OAT) ELISA Kit

20-abx152577
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Aspartate Aminotransferase (GOT1) ELISA Kit

abx252048-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human AST(Aspartate Aminotransferase) ELISA Kit

EH2671 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q9NRA2
  • Alias: AST
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Aspartate aminotransferase, AST ELISA Kit

ELA-E1214h 96 Tests
EUR 824

Aspartate Aminotransferase (AST) (Human) ELISA Kit

E4319-100
EUR 805

Human Tyrosine aminotransferase, TAT ELISA KIT

ELI-24055h 96 Tests
EUR 824

Human Phosphoserine aminotransferase, PSAT1 ELISA KIT

ELI-30408h 96 Tests
EUR 824

Human Aspartate aminotransferase,AST ELISA Kit

CN-04514H1 96T
EUR 454

Human Aspartate aminotransferase,AST ELISA Kit

CN-04514H2 48T
EUR 303

Human Aspartate aminotransferase, AST ELISA Kit

CSB-E09603h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Aspartate aminotransferase, AST in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Aspartate aminotransferase, AST ELISA Kit

1-CSB-E09603h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Aspartate aminotransferase, AST in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Aspartate aminotransferase(AST)ELISA Kit

GA-E0903HM-48T 48T
EUR 289

Human Aspartate aminotransferase(AST)ELISA Kit

GA-E0903HM-96T 96T
EUR 466

Human Aspartate aminotransferase(AST)ELISA Kit

QY-E01244 96T
EUR 361

Human Ornithine Aminotransferase(OAT)ELISA Kit

QY-E02071 96T
EUR 361

Human Tyrosine Aminotransferase(TAT)ELISA Kit

QY-E02407 96T
EUR 361

Human Alanine aminotransferase activity ELISA Kit

QY-E05363 96T
EUR 361

Human Alanine Aminotransferase (ALT) ELISA Kit

RD-ALT-Hu-48Tests 48 Tests
EUR 478

Human Alanine Aminotransferase (ALT) ELISA Kit

RD-ALT-Hu-96Tests 96 Tests
EUR 662

Human Alanine Aminotransferase ELISA Kit (ALT)

RK00873 96 Tests
EUR 521

Human Aspartate Aminotransferase ELISA Kit (AST)

RK00953 96 Tests
EUR 521

Human Ornithine Aminotransferase ELISA Kit (OAT)

RK01981 96 Tests
EUR 521

Human Aspartate Aminotransferase (AST) ELISA Kit

RDR-AST-Hu-48Tests 48 Tests
EUR 522

Human Aspartate Aminotransferase (AST) ELISA Kit

RDR-AST-Hu-96Tests 96 Tests
EUR 724

Human Alanine Aminotransferase (ALT) ELISA Kit

RDR-ALT-Hu-48Tests 48 Tests
EUR 500

Human Alanine Aminotransferase (ALT) ELISA Kit

RDR-ALT-Hu-96Tests 96 Tests
EUR 692

Human Ornithine Aminotransferase (OAT) ELISA Kit

SED860Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ornithine Aminotransferase (OAT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ornithine Aminotransferase (OAT) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Ornithine Aminotransferase (OAT) ELISA Kit

SED860Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ornithine Aminotransferase (OAT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ornithine Aminotransferase (OAT) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Ornithine Aminotransferase (OAT) ELISA Kit

SED860Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ornithine Aminotransferase (OAT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ornithine Aminotransferase (OAT) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Ornithine Aminotransferase (OAT) ELISA Kit

SED860Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ornithine Aminotransferase (OAT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ornithine Aminotransferase (OAT) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Ornithine Aminotransferase (OAT) ELISA Kit

4-SED860Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Ornithine Aminotransferase elisa. Alternative names of the recognized antigen: HOGA
  • Grate Arophy
  • Ornithine delta-aminotransferase
  • Ornithine--oxo-acid aminotransferase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ornithine Aminotransferase (OAT) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Alanine Aminotransferase (ALT) ELISA Kit

SEA207Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Alanine Aminotransferase (ALT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Alanine Aminotransferase (ALT) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Alanine Aminotransferase (ALT) ELISA Kit

SEA207Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Alanine Aminotransferase (ALT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Alanine Aminotransferase (ALT) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Alanine Aminotransferase (ALT) ELISA Kit

SEA207Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Alanine Aminotransferase (ALT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Alanine Aminotransferase (ALT) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Alanine Aminotransferase (ALT) ELISA Kit

SEA207Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Alanine Aminotransferase (ALT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Alanine Aminotransferase (ALT) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Alanine Aminotransferase (ALT) ELISA Kit

4-SEA207Hu
  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Alanine Aminotransferase elisa. Alternative names of the recognized antigen: GPT
  • ALAT
  • SGPT
  • AAT1
  • GPT1
  • Serum Glutamic Pyruvic Transaminase
  • Alanine Transaminase
  • Glutamate pyruvate transaminase 1
  • Glutamic--alanine transaminase 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Alanine Aminotransferase (ALT) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Aspartate Aminotransferase (AST) ELISA Kit

SEB214Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aspartate Aminotransferase (AST) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aspartate Aminotransferase (AST) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Aspartate Aminotransferase (AST) ELISA Kit

SEB214Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aspartate Aminotransferase (AST) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aspartate Aminotransferase (AST) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Aspartate Aminotransferase (AST) ELISA Kit

SEB214Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aspartate Aminotransferase (AST) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aspartate Aminotransferase (AST) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Aspartate Aminotransferase (AST) ELISA Kit

SEB214Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aspartate Aminotransferase (AST) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aspartate Aminotransferase (AST) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Aspartate Aminotransferase (AST) ELISA Kit

4-SEB214Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Aspartate Aminotransferase elisa. Alternative names of the recognized antigen: cCAT
  • AAT
  • ASAT
  • SGOT
  • GOT1
  • Cysteine transaminase, cytoplasmic
  • Transaminase A
  • Aspartate Transaminase 1, Cytoplasmic
  • Glutamic-Oxaloacetic Transaminase 1,
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Aspartate Aminotransferase (AST) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Aspartate Aminotransferase (AST) ELISA Kit

RD-AST-Hu-48Tests 48 Tests
EUR 500

Human Aspartate Aminotransferase (AST) ELISA Kit

RD-AST-Hu-96Tests 96 Tests
EUR 692

AADAT Polyclonal Antibody

27892-100ul 100ul
EUR 252

AADAT Polyclonal Antibody

27892-50ul 50ul
EUR 187

AADAT Polyclonal Antibody

27893-100ul 100ul
EUR 252

AADAT Polyclonal Antibody

27893-50ul 50ul
EUR 187

AADAT Rabbit pAb

A13089-100ul 100 ul
EUR 308

AADAT Rabbit pAb

A13089-200ul 200 ul
EUR 459

AADAT Rabbit pAb

A13089-20ul 20 ul
EUR 183

AADAT Rabbit pAb

A13089-50ul 50 ul
EUR 223

AADAT Rabbit pAb

A13090-100ul 100 ul
EUR 308

AADAT Rabbit pAb

A13090-200ul 200 ul
EUR 459

AADAT Rabbit pAb

A13090-20ul 20 ul
EUR 183

AADAT Rabbit pAb

A13090-50ul 50 ul
EUR 223

AADAT Blocking Peptide

33R-2491 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AADAT antibody, catalog no. 70R-2917

AADAT Blocking Peptide

33R-1601 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AADAT antibody, catalog no. 70R-1120

AADAT Blocking Peptide

DF12804-BP 1mg
EUR 195

AADAT cloning plasmid

CSB-CL843276HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1290
  • Sequence: atgaattacgcacggttcatcacggcagcgagcgcagccagaaacccttctcccatccggaccatgagtgagaaacgggctgacatattgagcagaggaccaaaatcgatgatctccttggctggtggcttaccaaatccaaacatgtttccttttaagactgccgtaatcactg
  • Show more
Description: A cloning plasmid for the AADAT gene.

AADAT Polyclonal Antibody

A66746 100 µg
EUR 570.55
Description: The best epigenetics products

Human AADAT(Aminoadipate Aminotransferase) ELISA Kit