Human SYCN(Syncollin) ELISA Kit

Human SYCN(Syncollin) ELISA Kit

Human Syncollin (SYCN) ELISA Kit
RD-SYCN-Hu-48Tests 48 Tests
EUR 521

Human Syncollin (SYCN) ELISA Kit
RD-SYCN-Hu-96Tests 96 Tests
EUR 723

Human Syncollin (SYCN) ELISA Kit
RDR-SYCN-Hu-48Tests 48 Tests
EUR 544

Human Syncollin (SYCN) ELISA Kit
RDR-SYCN-Hu-96Tests 96 Tests
EUR 756

Human SYCN(Syncollin) ELISA Kit
EH3837 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q0VAF6
  • Alias: SYCN/Syncollin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Syncollin, SYCN ELISA KIT
ELI-52181h 96 Tests
EUR 824

Human Syncollin (SYCN) ELISA Kit
20-abx153204
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Syncollin (SYCN) ELISA Kit
abx253231-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Syncollin(SYCN)ELISA Kit
QY-E04566 96T
EUR 361

Human Syncollin (SYCN) ELISA Kit
SED879Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncollin (SYCN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncollin (SYCN) in serum, plasma, tissue homogenates and other biological fluids.

Human Syncollin (SYCN) ELISA Kit
SED879Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncollin (SYCN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncollin (SYCN) in serum, plasma, tissue homogenates and other biological fluids.

Human Syncollin (SYCN) ELISA Kit
SED879Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncollin (SYCN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncollin (SYCN) in serum, plasma, tissue homogenates and other biological fluids.

Human Syncollin (SYCN) ELISA Kit
SED879Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncollin (SYCN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncollin (SYCN) in serum, plasma, tissue homogenates and other biological fluids.

Human Syncollin (SYCN) ELISA Kit
4-SED879Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Syncollin elisa. Alternative names of the recognized antigen: SYL
  • INSSA1
  • Insulin Synthesis Associated 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Syncollin (SYCN) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Syncollin, Sycn ELISA KIT
ELI-53111m 96 Tests
EUR 865

Chicken Syncollin (SYCN) ELISA Kit
abx354644-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Syncollin (SYCN) ELISA Kit
abx354939-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Syncollin (SYCN) ELISA Kit
abx355086-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Syncollin (SYCN) ELISA Kit
abx355322-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Syncollin (Sycn) ELISA Kit
abx390692-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Syncollin (Sycn) ELISA Kit
abx392037-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Syncollin (SYCN) Antibody
20-abx131613
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Syncollin (SYCN) Antibody
20-abx174694
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Syncollin (SYCN) Antibody
20-abx305475
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Syncollin (SYCN)
4-RPD879Hu01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q0VAF6
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 40.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Syncollin expressed in: E.coli

ELISA kit for Human SYCN (Syncollin)
ELK3086 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Syncollin (SYCN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Syncollin (SYCN).
  • Show more
Description: A sandwich ELISA kit for detection of Syncollin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human SYCN (Syncollin)
E-EL-H1005 1 plate of 96 wells
EUR 534
  • Gentaur's SYCN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human SYCN. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human SYCN (Syncollin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human Syncollin (SYCN)
KTE60408-48T 48T
EUR 332
  • Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Syncollin (SYCN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Syncollin (SYCN)
KTE60408-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Syncollin (SYCN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Syncollin (SYCN)
KTE60408-96T 96T
EUR 539
  • Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Syncollin (SYCN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Syncollin (SYCN) CLIA Kit
20-abx494426
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Syncollin (SYCN) CLIA Kit
abx197741-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Syncollin (SYCN) Protein
20-abx650526
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Sycn ELISA Kit| Rat Syncollin ELISA Kit
EF019397 96 Tests
EUR 689

Sycn ELISA Kit| Mouse Syncollin ELISA Kit
EF016335 96 Tests
EUR 689

Syncollin (SYCN) Antibody (HRP)
20-abx305476
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Syncollin (SYCN) Antibody (FITC)
20-abx305477
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Syncollin (SYCN) Antibody (Biotin)
20-abx305478
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CLIA kit for Human SYCN (Syncollin)
E-CL-H0677 1 plate of 96 wells
EUR 584
  • Gentaur's SYCN CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human SYCN . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human SYCN (Syncollin) in samples from Serum, Plasma, Cell supernatant

Syncollin (SYCN) Polyclonal Antibody (Human)
4-PAD879Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SYCN (Cys38~Ser134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Syncollin (SYCN)

Syncollin (SYCN) Polyclonal Antibody (Human), APC
4-PAD879Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SYCN (Cys38~Ser134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Syncollin (SYCN). This antibody is labeled with APC.

Syncollin (SYCN) Polyclonal Antibody (Human), Biotinylated
4-PAD879Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SYCN (Cys38~Ser134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Syncollin (SYCN). This antibody is labeled with Biotin.

Syncollin (SYCN) Polyclonal Antibody (Human), Cy3
4-PAD879Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SYCN (Cys38~Ser134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Syncollin (SYCN). This antibody is labeled with Cy3.

Syncollin (SYCN) Polyclonal Antibody (Human), FITC
4-PAD879Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SYCN (Cys38~Ser134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Syncollin (SYCN). This antibody is labeled with FITC.

Syncollin (SYCN) Polyclonal Antibody (Human), HRP
4-PAD879Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SYCN (Cys38~Ser134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Syncollin (SYCN). This antibody is labeled with HRP.

Syncollin (SYCN) Polyclonal Antibody (Human), PE
4-PAD879Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SYCN (Cys38~Ser134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Syncollin (SYCN). This antibody is labeled with PE.

Syncollin (SYCN) Polyclonal Antibody (Human), APC-Cy7
4-PAD879Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SYCN (Cys38~Ser134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Syncollin (SYCN). This antibody is labeled with APC-Cy7.

Sycn/ Rat Sycn ELISA Kit
ELI-23601r 96 Tests
EUR 886

SYCN ELISA KIT|Human
EF007197 96 Tests
EUR 689

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202

SYCN siRNA
20-abx905390
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SYCN siRNA
20-abx935764
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SYCN siRNA
20-abx935765
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SYCN Antibody
1-CSB-PA022989LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYCN. Recognizes SYCN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

anti-SYCN
YF-PA23003 100 ug
EUR 403
Description: Rabbit polyclonal to SYCN

Human SYCN shRNA Plasmid
20-abx967407
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SYCN Recombinant Protein (Human)
RP043870 100 ug Ask for price

SYCN cloning plasmid
CSB-CL022989HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 405
  • Sequence: ATGTCCCCGCTGCGCCCGCTGCTGCTGGCCCTGGCCCTTGCCTCCGTGCCTTGCGCCCAGGGCGCCTGCCCCGCCTCCGCCGACCTCAAGCACTCGGACGGGACGCGCACTTGCGCCAAGCTCTATGACAAGAGCGACCCCTACTATGAGAACTGCTGCGGGGGCGCCGAGCTGTC
  • Show more
Description: A cloning plasmid for the SYCN gene.

SYCN Polyclonal Antibody
A63528 100 µg
EUR 570.55
Description: kits suitable for this type of research

SYCN ORF Vector (Human) (pORF)
ORF014624 1.0 ug DNA
EUR 354

Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Mouse SYCN shRNA Plasmid
20-abx976605
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat SYCN shRNA Plasmid
20-abx987899
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SYCN Antibody, HRP conjugated
1-CSB-PA022989LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYCN. Recognizes SYCN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SYCN Antibody, FITC conjugated
1-CSB-PA022989LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYCN. Recognizes SYCN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SYCN Antibody, Biotin conjugated
1-CSB-PA022989LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYCN. Recognizes SYCN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SYCN Recombinant Protein (Rat)
RP231851 100 ug Ask for price

SYCN Recombinant Protein (Mouse)
RP176684 100 ug Ask for price

PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266

SYCN sgRNA CRISPR Lentivector set (Human)
K2318801 3 x 1.0 ug
EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

SYCN Polyclonal Antibody, HRP Conjugated
A63529 100 µg
EUR 570.55
Description: fast delivery possible

SYCN Polyclonal Antibody, FITC Conjugated
A63530 100 µg
EUR 570.55
Description: reagents widely cited

SYCN Polyclonal Antibody, Biotin Conjugated
A63531 100 µg
EUR 570.55
Description: Ask the seller for details

Sycn ORF Vector (Mouse) (pORF)
ORF058896 1.0 ug DNA
EUR 506

Sycn ORF Vector (Rat) (pORF)
ORF077285 1.0 ug DNA
EUR 506

SYCN sgRNA CRISPR Lentivector (Human) (Target 1)
K2318802 1.0 ug DNA
EUR 154

SYCN sgRNA CRISPR Lentivector (Human) (Target 2)
K2318803 1.0 ug DNA
EUR 154

SYCN sgRNA CRISPR Lentivector (Human) (Target 3)
K2318804 1.0 ug DNA
EUR 154

SYCN Protein Vector (Human) (pPB-C-His)
PV058493 500 ng
EUR 481

SYCN Protein Vector (Human) (pPB-N-His)
PV058494 500 ng
EUR 481

SYCN Protein Vector (Human) (pPM-C-HA)
PV058495 500 ng
EUR 481

SYCN Protein Vector (Human) (pPM-C-His)
PV058496 500 ng
EUR 481

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Sycn sgRNA CRISPR Lentivector set (Mouse)
K3485001 3 x 1.0 ug
EUR 339

Sycn sgRNA CRISPR Lentivector set (Rat)
K7384601 3 x 1.0 ug
EUR 339

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

vWF Acty. Kit
ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit
ABP-TOT-KIT 12 x 8 microwells
EUR 394

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9

Sycn sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3485002 1.0 ug DNA
EUR 154

Sycn sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3485003 1.0 ug DNA
EUR 154

Sycn sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3485004 1.0 ug DNA
EUR 154

Sycn sgRNA CRISPR Lentivector (Rat) (Target 1)
K7384602 1.0 ug DNA
EUR 154

Sycn sgRNA CRISPR Lentivector (Rat) (Target 2)
K7384603 1.0 ug DNA
EUR 154

Sycn sgRNA CRISPR Lentivector (Rat) (Target 3)
K7384604 1.0 ug DNA
EUR 154

SYCN Protein Vector (Rat) (pPB-C-His)
PV309138 500 ng
EUR 603

SYCN Protein Vector (Rat) (pPB-N-His)
PV309139 500 ng
EUR 603

SYCN Protein Vector (Rat) (pPM-C-HA)
PV309140 500 ng
EUR 603

SYCN Protein Vector (Rat) (pPM-C-His)
PV309141 500 ng
EUR 603

SYCN Protein Vector (Mouse) (pPB-C-His)
PV235582 500 ng
EUR 603

SYCN Protein Vector (Mouse) (pPB-N-His)
PV235583 500 ng
EUR 603

SYCN Protein Vector (Mouse) (pPM-C-HA)
PV235584 500 ng
EUR 603

SYCN Protein Vector (Mouse) (pPM-C-His)
PV235585 500 ng
EUR 603

Sycn 3'UTR GFP Stable Cell Line
TU170000 1.0 ml Ask for price

Sycn 3'UTR Luciferase Stable Cell Line
TU120000 1.0 ml Ask for price

SYCN 3'UTR GFP Stable Cell Line
TU074981 1.0 ml
EUR 1394

SYCN 3'UTR Luciferase Stable Cell Line
TU024981 1.0 ml
EUR 1394

Sycn 3'UTR Luciferase Stable Cell Line
TU221448 1.0 ml Ask for price

Sycn 3'UTR GFP Stable Cell Line
TU271448 1.0 ml Ask for price

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

SYCN sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2318805 3 x 1.0 ug
EUR 376

SYCN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV650113 1.0 ug DNA
EUR 514

SYCN Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV650117 1.0 ug DNA
EUR 514

SYCN Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV650118 1.0 ug DNA
EUR 514

Recombinant Yersinia Enterocolitica sycN Protein (aa 1-123)
VAng-Cr2333-1mgEcoli 1 mg (E. coli)
EUR 3022
Description: Yersinia Enterocolitica chaperone protein sycN (sycN), recombinant protein.

Recombinant Yersinia Enterocolitica sycN Protein (aa 1-123)
VAng-Cr2333-500gEcoli 500 µg (E. coli)
EUR 2168
Description: Yersinia Enterocolitica chaperone protein sycN (sycN), recombinant protein.

Recombinant Yersinia Enterocolitica sycN Protein (aa 1-123)
VAng-Cr2333-50gEcoli 50 µg (E. coli)
EUR 1477
Description: Yersinia Enterocolitica chaperone protein sycN (sycN), recombinant protein.

SYCN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2318806 1.0 ug DNA
EUR 167

SYCN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2318807 1.0 ug DNA
EUR 167

Human SYCN(Syncollin) ELISA Kit